Incidental Mutation 'R7183:Spata31e2'
ID 559085
Institutional Source Beutler Lab
Gene Symbol Spata31e2
Ensembl Gene ENSMUSG00000073722
Gene Name spermatogenesis associated 31 subfamily E member 2
Synonyms 4931408C20Rik
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 26720895-26726541 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26721914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1089 (L1089F)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
AlphaFold E9PWP9
Predicted Effect probably benign
Transcript: ENSMUST00000097801
AA Change: L1089F

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: L1089F

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Spata31e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Spata31e2 APN 1 26,724,058 (GRCm39) missense probably benign 0.00
IGL00575:Spata31e2 APN 1 26,722,013 (GRCm39) missense possibly damaging 0.51
IGL00656:Spata31e2 APN 1 26,721,982 (GRCm39) missense possibly damaging 0.71
IGL00671:Spata31e2 APN 1 26,723,940 (GRCm39) missense possibly damaging 0.50
IGL00777:Spata31e2 APN 1 26,721,173 (GRCm39) missense probably damaging 1.00
IGL00824:Spata31e2 APN 1 26,722,670 (GRCm39) missense possibly damaging 0.48
IGL01018:Spata31e2 APN 1 26,721,991 (GRCm39) missense probably damaging 0.99
IGL01148:Spata31e2 APN 1 26,724,253 (GRCm39) missense probably benign 0.22
IGL01631:Spata31e2 APN 1 26,724,495 (GRCm39) missense probably damaging 0.98
IGL01901:Spata31e2 APN 1 26,721,665 (GRCm39) missense probably benign 0.13
IGL01957:Spata31e2 APN 1 26,724,340 (GRCm39) missense probably damaging 0.98
IGL02031:Spata31e2 APN 1 26,724,104 (GRCm39) missense probably damaging 0.99
IGL02596:Spata31e2 APN 1 26,723,083 (GRCm39) missense probably benign 0.00
PIT4486001:Spata31e2 UTSW 1 26,724,410 (GRCm39) missense probably damaging 0.99
R0026:Spata31e2 UTSW 1 26,722,450 (GRCm39) missense probably benign 0.00
R0026:Spata31e2 UTSW 1 26,722,450 (GRCm39) missense probably benign 0.00
R0043:Spata31e2 UTSW 1 26,722,883 (GRCm39) missense possibly damaging 0.72
R0141:Spata31e2 UTSW 1 26,722,863 (GRCm39) missense probably benign 0.00
R0145:Spata31e2 UTSW 1 26,726,413 (GRCm39) missense probably benign 0.00
R0158:Spata31e2 UTSW 1 26,723,032 (GRCm39) missense probably damaging 0.98
R0325:Spata31e2 UTSW 1 26,724,347 (GRCm39) missense possibly damaging 0.91
R0627:Spata31e2 UTSW 1 26,724,970 (GRCm39) missense probably benign 0.00
R0733:Spata31e2 UTSW 1 26,722,013 (GRCm39) missense possibly damaging 0.51
R1033:Spata31e2 UTSW 1 26,721,466 (GRCm39) missense probably benign
R1074:Spata31e2 UTSW 1 26,722,307 (GRCm39) missense probably benign 0.00
R1108:Spata31e2 UTSW 1 26,721,547 (GRCm39) missense possibly damaging 0.85
R1139:Spata31e2 UTSW 1 26,721,746 (GRCm39) missense probably benign 0.04
R1326:Spata31e2 UTSW 1 26,723,011 (GRCm39) missense probably damaging 1.00
R1398:Spata31e2 UTSW 1 26,724,422 (GRCm39) missense possibly damaging 0.82
R1422:Spata31e2 UTSW 1 26,721,547 (GRCm39) missense possibly damaging 0.85
R1463:Spata31e2 UTSW 1 26,721,222 (GRCm39) nonsense probably null
R1485:Spata31e2 UTSW 1 26,724,961 (GRCm39) missense possibly damaging 0.92
R1568:Spata31e2 UTSW 1 26,724,950 (GRCm39) missense probably benign 0.01
R1603:Spata31e2 UTSW 1 26,724,650 (GRCm39) missense probably damaging 0.99
R1605:Spata31e2 UTSW 1 26,723,511 (GRCm39) missense possibly damaging 0.92
R1795:Spata31e2 UTSW 1 26,722,070 (GRCm39) nonsense probably null
R1945:Spata31e2 UTSW 1 26,721,395 (GRCm39) missense probably benign 0.04
R1967:Spata31e2 UTSW 1 26,722,454 (GRCm39) missense probably benign 0.02
R2055:Spata31e2 UTSW 1 26,724,813 (GRCm39) missense possibly damaging 0.86
R2093:Spata31e2 UTSW 1 26,721,222 (GRCm39) nonsense probably null
R2131:Spata31e2 UTSW 1 26,724,935 (GRCm39) missense probably benign 0.11
R2237:Spata31e2 UTSW 1 26,724,241 (GRCm39) missense possibly damaging 0.82
R2314:Spata31e2 UTSW 1 26,723,783 (GRCm39) missense probably benign 0.00
R2407:Spata31e2 UTSW 1 26,721,919 (GRCm39) missense possibly damaging 0.86
R2993:Spata31e2 UTSW 1 26,724,909 (GRCm39) missense possibly damaging 0.83
R4245:Spata31e2 UTSW 1 26,721,161 (GRCm39) missense probably benign 0.00
R4567:Spata31e2 UTSW 1 26,722,198 (GRCm39) missense probably benign
R4605:Spata31e2 UTSW 1 26,722,267 (GRCm39) missense probably benign 0.45
R4708:Spata31e2 UTSW 1 26,723,521 (GRCm39) missense possibly damaging 0.92
R4827:Spata31e2 UTSW 1 26,724,923 (GRCm39) missense possibly damaging 0.91
R4839:Spata31e2 UTSW 1 26,724,440 (GRCm39) missense probably benign 0.11
R4888:Spata31e2 UTSW 1 26,722,628 (GRCm39) missense probably benign 0.00
R5075:Spata31e2 UTSW 1 26,722,133 (GRCm39) missense probably damaging 0.99
R5101:Spata31e2 UTSW 1 26,722,417 (GRCm39) missense possibly damaging 0.92
R5231:Spata31e2 UTSW 1 26,723,032 (GRCm39) missense possibly damaging 0.79
R5310:Spata31e2 UTSW 1 26,724,169 (GRCm39) missense probably benign 0.00
R5459:Spata31e2 UTSW 1 26,724,272 (GRCm39) missense probably damaging 0.96
R5520:Spata31e2 UTSW 1 26,724,900 (GRCm39) missense probably benign 0.00
R5608:Spata31e2 UTSW 1 26,722,129 (GRCm39) missense probably damaging 0.97
R5960:Spata31e2 UTSW 1 26,722,225 (GRCm39) missense probably benign 0.34
R6128:Spata31e2 UTSW 1 26,724,506 (GRCm39) missense probably benign 0.38
R6188:Spata31e2 UTSW 1 26,724,784 (GRCm39) missense probably damaging 0.99
R6319:Spata31e2 UTSW 1 26,724,482 (GRCm39) missense probably benign 0.38
R6339:Spata31e2 UTSW 1 26,721,586 (GRCm39) missense probably benign 0.01
R6431:Spata31e2 UTSW 1 26,723,111 (GRCm39) missense probably benign 0.11
R6456:Spata31e2 UTSW 1 26,724,250 (GRCm39) missense probably damaging 0.99
R6562:Spata31e2 UTSW 1 26,721,443 (GRCm39) missense possibly damaging 0.91
R6645:Spata31e2 UTSW 1 26,722,198 (GRCm39) missense probably benign 0.06
R6647:Spata31e2 UTSW 1 26,721,659 (GRCm39) missense probably damaging 0.99
R6919:Spata31e2 UTSW 1 26,722,015 (GRCm39) missense probably benign 0.15
R7085:Spata31e2 UTSW 1 26,722,546 (GRCm39) missense possibly damaging 0.95
R7347:Spata31e2 UTSW 1 26,723,548 (GRCm39) missense probably benign 0.02
R7488:Spata31e2 UTSW 1 26,723,039 (GRCm39) missense possibly damaging 0.77
R7565:Spata31e2 UTSW 1 26,724,351 (GRCm39) missense probably benign 0.00
R7726:Spata31e2 UTSW 1 26,723,579 (GRCm39) missense probably benign 0.08
R8258:Spata31e2 UTSW 1 26,721,562 (GRCm39) missense probably benign 0.28
R8259:Spata31e2 UTSW 1 26,721,562 (GRCm39) missense probably benign 0.28
R8701:Spata31e2 UTSW 1 26,724,526 (GRCm39) missense probably benign 0.21
R8905:Spata31e2 UTSW 1 26,721,895 (GRCm39) missense probably damaging 0.97
R9137:Spata31e2 UTSW 1 26,724,715 (GRCm39) missense probably benign 0.13
R9138:Spata31e2 UTSW 1 26,721,253 (GRCm39) missense possibly damaging 0.90
R9170:Spata31e2 UTSW 1 26,723,485 (GRCm39) missense possibly damaging 0.93
R9287:Spata31e2 UTSW 1 26,722,426 (GRCm39) missense possibly damaging 0.51
R9331:Spata31e2 UTSW 1 26,722,790 (GRCm39) missense probably benign 0.00
R9535:Spata31e2 UTSW 1 26,721,232 (GRCm39) nonsense probably null
R9719:Spata31e2 UTSW 1 26,722,820 (GRCm39) missense probably benign 0.02
X0025:Spata31e2 UTSW 1 26,721,586 (GRCm39) missense probably benign 0.00
X0061:Spata31e2 UTSW 1 26,721,650 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGGCATTAACATTGGGCTG -3'
(R):5'- ACCAGAGATCGTGTGACCTAGG -3'

Sequencing Primer
(F):5'- AACATTGGGCTGTGATTCATCTC -3'
(R):5'- TCGTGTGACCTAGGCCAAAG -3'
Posted On 2019-06-26