Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Ercc5'

559086

Institutional Source

Beutler Lab

Gene Symbol

Ercc5

Ensembl Gene

ENSMUSG00000026048

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 5

Synonyms

Xpg

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44147744-44181260 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 44161808 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027214]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000027214

SMART Domains

Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048

Domain	Start	End	E-Value	Type
XPGN	1	98	3.49e-50	SMART
low complexity region	104	115	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
low complexity region	641	650	N/A	INTRINSIC
XPGI	776	845	1.02e-33	SMART
HhH2	847	880	2.94e-11	SMART
low complexity region	1130	1140	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC

Meta Mutation Damage Score

0.9597

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Ercc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Ercc5	APN	1	44163898	missense	probably damaging	1.00
IGL00782:Ercc5	APN	1	44163935	missense	probably damaging	1.00
IGL01418:Ercc5	APN	1	44167280	missense	probably benign	0.43
IGL01710:Ercc5	APN	1	44164075	missense	probably damaging	1.00
IGL02528:Ercc5	APN	1	44167802	missense	probably benign	0.00
IGL02589:Ercc5	APN	1	44164049	missense	probably damaging	1.00
IGL02651:Ercc5	APN	1	44156944	missense	probably damaging	1.00
IGL02740:Ercc5	APN	1	44167492	missense	probably benign	0.00
IGL02999:Ercc5	APN	1	44167654	missense	probably benign	0.00
IGL03057:Ercc5	APN	1	44167001	missense	probably damaging	0.99
IGL03246:Ercc5	APN	1	44167081	missense	probably damaging	1.00
R0084:Ercc5	UTSW	1	44175976	missense	possibly damaging	0.53
R0448:Ercc5	UTSW	1	44173940	missense	probably damaging	1.00
R1120:Ercc5	UTSW	1	44161841	missense	probably damaging	1.00
R1312:Ercc5	UTSW	1	44164019	missense	probably damaging	1.00
R1411:Ercc5	UTSW	1	44178281	missense	probably damaging	0.99
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1528:Ercc5	UTSW	1	44178241	nonsense	probably null
R1637:Ercc5	UTSW	1	44167534	missense	probably benign	0.00
R1668:Ercc5	UTSW	1	44167033	missense	probably benign	0.04
R1714:Ercc5	UTSW	1	44167339	missense	probably benign	0.01
R1780:Ercc5	UTSW	1	44167796	missense	probably benign	0.17
R1800:Ercc5	UTSW	1	44173380	missense	probably benign	0.00
R1835:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1836:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1886:Ercc5	UTSW	1	44175976	nonsense	probably null
R2344:Ercc5	UTSW	1	44167169	missense	probably benign
R2680:Ercc5	UTSW	1	44156973	missense	probably benign	0.09
R3033:Ercc5	UTSW	1	44180574	missense	possibly damaging	0.83
R3919:Ercc5	UTSW	1	44161931	missense	probably damaging	1.00
R3933:Ercc5	UTSW	1	44167856	missense	probably benign	0.17
R4444:Ercc5	UTSW	1	44158209	frame shift	probably null
R4578:Ercc5	UTSW	1	44148148	missense	probably benign	0.32
R4585:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4586:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4911:Ercc5	UTSW	1	44166871	missense	possibly damaging	0.66
R4912:Ercc5	UTSW	1	44157057	missense	probably damaging	1.00
R4942:Ercc5	UTSW	1	44175965	missense	probably benign	0.09
R5155:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
R5975:Ercc5	UTSW	1	44173406	missense	probably benign	0.04
R5991:Ercc5	UTSW	1	44180830	nonsense	probably null
R6161:Ercc5	UTSW	1	44167352	missense	probably benign	0.00
R6250:Ercc5	UTSW	1	44164049	missense	probably damaging	1.00
R7142:Ercc5	UTSW	1	44174214	missense	probably damaging	1.00
R7183:Ercc5	UTSW	1	44161809	critical splice acceptor site	probably null
R7235:Ercc5	UTSW	1	44178203	missense	possibly damaging	0.68
R7349:Ercc5	UTSW	1	44180908	missense	possibly damaging	0.56
R7369:Ercc5	UTSW	1	44180860	missense	probably benign	0.39
R7486:Ercc5	UTSW	1	44148064	start codon destroyed	probably null	1.00
R7586:Ercc5	UTSW	1	44175851	missense	possibly damaging	0.49
R7904:Ercc5	UTSW	1	44175838	critical splice acceptor site	probably null
R7994:Ercc5	UTSW	1	44178334	missense	possibly damaging	0.94
R8432:Ercc5	UTSW	1	44167681	nonsense	probably null
R8795:Ercc5	UTSW	1	44163929	missense	possibly damaging	0.92
R9144:Ercc5	UTSW	1	44174351	missense	probably damaging	1.00
R9208:Ercc5	UTSW	1	44178343	missense	possibly damaging	0.51
R9295:Ercc5	UTSW	1	44158857	missense	probably damaging	1.00
R9516:Ercc5	UTSW	1	44167881	missense	probably damaging	1.00
X0011:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
X0062:Ercc5	UTSW	1	44173974	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTCTTTTCAAAACAACGGACC -3'
(R):5'- TGTGAAGCTTTGCTCAAGTTC -3'

Sequencing Primer
(F):5'- ATGCATGACACCCTGGATTC -3'
(R):5'- CAAGTTCTTAGTTCTAAGCACTGGTG -3'

Posted On

2019-06-26