Incidental Mutation 'R7183:Ercc5'
ID 559086
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 44186904-44220420 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 44200968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027214
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44,203,058 (GRCm39) missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44,203,095 (GRCm39) missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44,206,440 (GRCm39) missense probably benign 0.43
IGL01710:Ercc5 APN 1 44,203,235 (GRCm39) missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44,206,962 (GRCm39) missense probably benign 0.00
IGL02589:Ercc5 APN 1 44,203,209 (GRCm39) missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44,196,104 (GRCm39) missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44,206,652 (GRCm39) missense probably benign 0.00
IGL02999:Ercc5 APN 1 44,206,814 (GRCm39) missense probably benign 0.00
IGL03057:Ercc5 APN 1 44,206,161 (GRCm39) missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44,206,241 (GRCm39) missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44,215,136 (GRCm39) missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44,213,100 (GRCm39) missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44,201,001 (GRCm39) missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44,203,179 (GRCm39) missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44,217,441 (GRCm39) missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44,219,784 (GRCm39) missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44,219,784 (GRCm39) missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44,217,401 (GRCm39) nonsense probably null
R1637:Ercc5 UTSW 1 44,206,694 (GRCm39) missense probably benign 0.00
R1668:Ercc5 UTSW 1 44,206,193 (GRCm39) missense probably benign 0.04
R1714:Ercc5 UTSW 1 44,206,499 (GRCm39) missense probably benign 0.01
R1780:Ercc5 UTSW 1 44,206,956 (GRCm39) missense probably benign 0.17
R1800:Ercc5 UTSW 1 44,212,540 (GRCm39) missense probably benign 0.00
R1835:Ercc5 UTSW 1 44,220,035 (GRCm39) missense probably benign 0.00
R1836:Ercc5 UTSW 1 44,220,035 (GRCm39) missense probably benign 0.00
R1886:Ercc5 UTSW 1 44,215,136 (GRCm39) nonsense probably null
R2344:Ercc5 UTSW 1 44,206,329 (GRCm39) missense probably benign
R2680:Ercc5 UTSW 1 44,196,133 (GRCm39) missense probably benign 0.09
R3033:Ercc5 UTSW 1 44,219,734 (GRCm39) missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44,201,091 (GRCm39) missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44,207,016 (GRCm39) missense probably benign 0.17
R4444:Ercc5 UTSW 1 44,197,369 (GRCm39) frame shift probably null
R4578:Ercc5 UTSW 1 44,187,308 (GRCm39) missense probably benign 0.32
R4585:Ercc5 UTSW 1 44,198,017 (GRCm39) missense probably benign 0.36
R4586:Ercc5 UTSW 1 44,198,017 (GRCm39) missense probably benign 0.36
R4911:Ercc5 UTSW 1 44,206,031 (GRCm39) missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44,196,217 (GRCm39) missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44,215,125 (GRCm39) missense probably benign 0.09
R5155:Ercc5 UTSW 1 44,219,782 (GRCm39) missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44,212,566 (GRCm39) missense probably benign 0.04
R5991:Ercc5 UTSW 1 44,219,990 (GRCm39) nonsense probably null
R6161:Ercc5 UTSW 1 44,206,512 (GRCm39) missense probably benign 0.00
R6250:Ercc5 UTSW 1 44,203,209 (GRCm39) missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44,213,374 (GRCm39) missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44,200,969 (GRCm39) critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44,217,363 (GRCm39) missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44,220,068 (GRCm39) missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44,220,020 (GRCm39) missense probably benign 0.39
R7486:Ercc5 UTSW 1 44,187,224 (GRCm39) start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44,215,011 (GRCm39) missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44,214,998 (GRCm39) critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44,217,494 (GRCm39) missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44,206,841 (GRCm39) nonsense probably null
R8795:Ercc5 UTSW 1 44,203,089 (GRCm39) missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44,213,511 (GRCm39) missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44,217,503 (GRCm39) missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44,198,017 (GRCm39) missense probably damaging 1.00
R9516:Ercc5 UTSW 1 44,207,041 (GRCm39) missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44,219,782 (GRCm39) missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44,213,134 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTTTTCAAAACAACGGACC -3'
(R):5'- TGTGAAGCTTTGCTCAAGTTC -3'

Sequencing Primer
(F):5'- ATGCATGACACCCTGGATTC -3'
(R):5'- CAAGTTCTTAGTTCTAAGCACTGGTG -3'
Posted On 2019-06-26