Incidental Mutation 'R7183:Dennd1b'
ID 559089
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene Name DENN domain containing 1B
Synonyms F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 138891447-139103781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139097990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 677 (Q677L)
Ref Sequence ENSEMBL: ENSMUSP00000092082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000200429]
AlphaFold Q3U1T9
Predicted Effect unknown
Transcript: ENSMUST00000094505
AA Change: Q677L
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: Q677L

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168527
AA Change: Q752L
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: Q752L

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200429
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 138,990,678 (GRCm39) missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139,029,809 (GRCm39) missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139,061,475 (GRCm39) missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139,097,977 (GRCm39) missense probably benign 0.01
IGL00959:Dennd1b APN 1 139,071,626 (GRCm39) splice site probably benign
IGL01446:Dennd1b APN 1 138,950,848 (GRCm39) missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139,097,504 (GRCm39) utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139,008,992 (GRCm39) missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139,096,705 (GRCm39) utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139,008,980 (GRCm39) missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139,029,767 (GRCm39) missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139,067,130 (GRCm39) missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 138,990,599 (GRCm39) nonsense probably null
Dendrite UTSW 1 138,981,155 (GRCm39) critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139,042,502 (GRCm39) intron probably benign
PIT4418001:Dennd1b UTSW 1 139,008,999 (GRCm39) missense
PIT4504001:Dennd1b UTSW 1 138,967,742 (GRCm39) missense probably benign 0.28
R0426:Dennd1b UTSW 1 139,097,934 (GRCm39) missense probably benign
R0445:Dennd1b UTSW 1 139,095,503 (GRCm39) splice site probably benign
R0497:Dennd1b UTSW 1 138,967,724 (GRCm39) splice site probably benign
R0627:Dennd1b UTSW 1 139,008,957 (GRCm39) missense probably damaging 1.00
R1027:Dennd1b UTSW 1 138,969,700 (GRCm39) missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139,095,468 (GRCm39) missense probably benign 0.01
R1703:Dennd1b UTSW 1 139,097,492 (GRCm39) critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139,018,143 (GRCm39) splice site probably null
R1943:Dennd1b UTSW 1 139,096,690 (GRCm39) utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139,097,908 (GRCm39) utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139,098,019 (GRCm39) missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 138,969,654 (GRCm39) splice site probably benign
R3843:Dennd1b UTSW 1 138,981,092 (GRCm39) missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139,071,697 (GRCm39) missense probably benign 0.00
R4258:Dennd1b UTSW 1 138,990,678 (GRCm39) missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139,013,665 (GRCm39) missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 138,981,122 (GRCm39) missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139,013,652 (GRCm39) missense probably damaging 0.99
R4954:Dennd1b UTSW 1 138,981,124 (GRCm39) missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139,061,459 (GRCm39) missense probably damaging 0.97
R5205:Dennd1b UTSW 1 138,982,306 (GRCm39) missense probably benign 0.00
R5240:Dennd1b UTSW 1 138,990,615 (GRCm39) missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139,095,409 (GRCm39) missense probably benign
R5504:Dennd1b UTSW 1 139,018,246 (GRCm39) missense probably benign 0.07
R5702:Dennd1b UTSW 1 139,061,413 (GRCm39) missense probably damaging 1.00
R5801:Dennd1b UTSW 1 138,967,727 (GRCm39) splice site probably null
R6144:Dennd1b UTSW 1 139,008,993 (GRCm39) missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139,061,413 (GRCm39) missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139,095,456 (GRCm39) missense probably benign 0.00
R6289:Dennd1b UTSW 1 139,096,683 (GRCm39) utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139,071,686 (GRCm39) missense probably benign 0.07
R6479:Dennd1b UTSW 1 138,969,698 (GRCm39) intron probably benign
R6940:Dennd1b UTSW 1 138,981,155 (GRCm39) critical splice donor site probably null
R6954:Dennd1b UTSW 1 139,096,683 (GRCm39) utr 3 prime probably benign
R7710:Dennd1b UTSW 1 138,990,670 (GRCm39) missense probably damaging 1.00
R7742:Dennd1b UTSW 1 138,990,611 (GRCm39) missense probably damaging 1.00
R7796:Dennd1b UTSW 1 138,990,611 (GRCm39) missense probably damaging 1.00
R7871:Dennd1b UTSW 1 138,990,611 (GRCm39) missense probably damaging 1.00
R7920:Dennd1b UTSW 1 138,990,611 (GRCm39) missense probably damaging 1.00
R7921:Dennd1b UTSW 1 138,990,611 (GRCm39) missense probably damaging 1.00
R7991:Dennd1b UTSW 1 139,013,634 (GRCm39) missense
R8025:Dennd1b UTSW 1 139,038,158 (GRCm39) missense
R8239:Dennd1b UTSW 1 138,969,673 (GRCm39) missense probably benign 0.02
R8526:Dennd1b UTSW 1 138,950,858 (GRCm39) nonsense probably null
R8532:Dennd1b UTSW 1 139,097,912 (GRCm39) utr 3 prime probably benign
R8691:Dennd1b UTSW 1 138,969,774 (GRCm39) missense possibly damaging 0.93
R9229:Dennd1b UTSW 1 138,981,100 (GRCm39) nonsense probably null
R9577:Dennd1b UTSW 1 139,018,196 (GRCm39) missense
RF008:Dennd1b UTSW 1 138,981,135 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTCCACTTCAGTCAG -3'
(R):5'- AGCAGAATTCGTTTTACGCTG -3'

Sequencing Primer
(F):5'- CACTTCAGTCAGAGGATCTGTCG -3'
(R):5'- CGTTTTACGCTGGGAAACC -3'
Posted On 2019-06-26