Incidental Mutation 'R7183:Gsn'
ID 559091
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Name gelsolin
Synonyms
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 35146392-35197904 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35184960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 305 (A305V)
Ref Sequence ENSEMBL: ENSMUSP00000028239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000139867] [ENSMUST00000142324] [ENSMUST00000201185] [ENSMUST00000202899] [ENSMUST00000202990]
AlphaFold P13020
PDB Structure Gelsolin Domains 4-6 in Active, Actin Free Conformation Identifies Sites of Regulatory Calcium Ions [X-RAY DIFFRACTION]
Crystal structure of Plasmodium falciparum actin I [X-RAY DIFFRACTION]
Crystal structure of Plasmodium berghei actin I with D-loop from muscle actin [X-RAY DIFFRACTION]
Crystal structure of Plasmodium berghei actin II [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028239
AA Change: A305V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: A305V

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139867
SMART Domains Protein: ENSMUSP00000144217
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142324
SMART Domains Protein: ENSMUSP00000118120
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 7.31e-30 SMART
GEL 134 226 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201185
AA Change: A256V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: A256V

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202899
SMART Domains Protein: ENSMUSP00000144470
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202990
AA Change: A267V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: A267V

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35,174,049 (GRCm39) missense probably damaging 1.00
IGL02119:Gsn APN 2 35,192,507 (GRCm39) missense probably damaging 1.00
IGL02512:Gsn APN 2 35,173,962 (GRCm39) nonsense probably null
IGL02550:Gsn APN 2 35,172,619 (GRCm39) intron probably benign
IGL02975:Gsn APN 2 35,194,666 (GRCm39) missense probably benign 0.25
IGL03061:Gsn APN 2 35,172,471 (GRCm39) intron probably benign
R0321:Gsn UTSW 2 35,180,408 (GRCm39) missense probably benign 0.03
R0454:Gsn UTSW 2 35,194,651 (GRCm39) missense probably damaging 1.00
R1446:Gsn UTSW 2 35,196,598 (GRCm39) missense probably benign 0.04
R1760:Gsn UTSW 2 35,174,835 (GRCm39) missense probably damaging 1.00
R1974:Gsn UTSW 2 35,191,483 (GRCm39) missense probably damaging 1.00
R2258:Gsn UTSW 2 35,180,349 (GRCm39) missense probably damaging 1.00
R2260:Gsn UTSW 2 35,180,349 (GRCm39) missense probably damaging 1.00
R2281:Gsn UTSW 2 35,173,930 (GRCm39) missense probably benign 0.01
R2495:Gsn UTSW 2 35,193,205 (GRCm39) missense probably damaging 1.00
R2516:Gsn UTSW 2 35,173,965 (GRCm39) missense probably benign
R3896:Gsn UTSW 2 35,192,650 (GRCm39) missense possibly damaging 0.92
R4003:Gsn UTSW 2 35,173,995 (GRCm39) missense probably benign 0.38
R4006:Gsn UTSW 2 35,197,633 (GRCm39) nonsense probably null
R4281:Gsn UTSW 2 35,188,883 (GRCm39) missense probably damaging 1.00
R4291:Gsn UTSW 2 35,180,432 (GRCm39) missense probably benign 0.14
R4692:Gsn UTSW 2 35,188,883 (GRCm39) missense probably damaging 1.00
R4850:Gsn UTSW 2 35,173,912 (GRCm39) splice site probably null
R4895:Gsn UTSW 2 35,192,590 (GRCm39) missense probably damaging 1.00
R5011:Gsn UTSW 2 35,188,933 (GRCm39) missense probably damaging 1.00
R5013:Gsn UTSW 2 35,188,933 (GRCm39) missense probably damaging 1.00
R5290:Gsn UTSW 2 35,186,484 (GRCm39) missense probably benign 0.01
R6472:Gsn UTSW 2 35,180,463 (GRCm39) splice site probably null
R6764:Gsn UTSW 2 35,174,056 (GRCm39) missense probably damaging 1.00
R7018:Gsn UTSW 2 35,183,518 (GRCm39) missense probably benign 0.03
R7036:Gsn UTSW 2 35,182,611 (GRCm39) missense probably damaging 1.00
R7097:Gsn UTSW 2 35,185,061 (GRCm39) nonsense probably null
R7122:Gsn UTSW 2 35,185,061 (GRCm39) nonsense probably null
R7203:Gsn UTSW 2 35,188,807 (GRCm39) missense probably benign 0.00
R7456:Gsn UTSW 2 35,172,718 (GRCm39) missense possibly damaging 0.84
R7488:Gsn UTSW 2 35,186,433 (GRCm39) missense possibly damaging 0.65
R7880:Gsn UTSW 2 35,173,939 (GRCm39) missense probably damaging 1.00
R8088:Gsn UTSW 2 35,182,659 (GRCm39) missense possibly damaging 0.77
R9472:Gsn UTSW 2 35,182,741 (GRCm39) missense probably damaging 1.00
R9479:Gsn UTSW 2 35,186,227 (GRCm39) critical splice donor site probably null
R9568:Gsn UTSW 2 35,174,003 (GRCm39) missense probably benign 0.02
R9777:Gsn UTSW 2 35,194,600 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTACATCTTGTCCGAGCC -3'
(R):5'- CTGGGACTGAGATTCTAGAAACC -3'

Sequencing Primer
(F):5'- AAAGTCTCACATATCCTGGGCTG -3'
(R):5'- TCTAGAAACCTGTGGTGACCTAG -3'
Posted On 2019-06-26