Incidental Mutation 'R7183:Ccdc39'
ID 559098
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Name coiled-coil domain containing 39
Synonyms b2b1735Clo, D3Ertd789e, prh, 4921507O14Rik, b2b1304Clo, b2b2025.1Clo
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.777) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 33866511-33898459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 33868620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 822 (E822A)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000199222]
AlphaFold Q9D5Y1
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: E822A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: E822A

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108210
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117915
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199222
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33,886,717 (GRCm39) missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33,871,107 (GRCm39) unclassified probably benign
IGL02426:Ccdc39 APN 3 33,879,547 (GRCm39) missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33,879,643 (GRCm39) missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33,884,267 (GRCm39) missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33,891,992 (GRCm39) missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33,898,301 (GRCm39) missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33,898,301 (GRCm39) missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33,873,988 (GRCm39) missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33,898,274 (GRCm39) missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33,869,634 (GRCm39) missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33,875,561 (GRCm39) missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33,893,294 (GRCm39) missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33,874,045 (GRCm39) missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33,869,650 (GRCm39) missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33,875,581 (GRCm39) missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33,890,882 (GRCm39) missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33,895,327 (GRCm39) missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33,869,633 (GRCm39) missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33,891,987 (GRCm39) missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33,868,646 (GRCm39) missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33,874,044 (GRCm39) missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33,874,044 (GRCm39) missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33,879,628 (GRCm39) missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33,892,031 (GRCm39) missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33,880,671 (GRCm39) missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33,873,955 (GRCm39) critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33,867,227 (GRCm39) missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33,893,242 (GRCm39) splice site probably null
R5236:Ccdc39 UTSW 3 33,884,251 (GRCm39) missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33,879,699 (GRCm39) missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33,871,086 (GRCm39) missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33,880,710 (GRCm39) missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33,895,341 (GRCm39) splice site probably null
R6375:Ccdc39 UTSW 3 33,868,516 (GRCm39) missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33,892,108 (GRCm39) missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33,884,242 (GRCm39) missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33,874,017 (GRCm39) missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33,884,254 (GRCm39) missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33,886,825 (GRCm39) missense possibly damaging 0.55
R7645:Ccdc39 UTSW 3 33,879,318 (GRCm39) splice site probably null
R7695:Ccdc39 UTSW 3 33,868,668 (GRCm39) missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33,886,766 (GRCm39) missense possibly damaging 0.55
R8487:Ccdc39 UTSW 3 33,886,808 (GRCm39) nonsense probably null
R8523:Ccdc39 UTSW 3 33,869,560 (GRCm39) critical splice donor site probably null
R8525:Ccdc39 UTSW 3 33,868,853 (GRCm39) missense probably benign 0.00
R8777:Ccdc39 UTSW 3 33,893,282 (GRCm39) missense probably benign
R8777-TAIL:Ccdc39 UTSW 3 33,893,282 (GRCm39) missense probably benign
R8842:Ccdc39 UTSW 3 33,880,612 (GRCm39) missense probably damaging 1.00
R8932:Ccdc39 UTSW 3 33,884,274 (GRCm39) missense probably benign 0.00
R8947:Ccdc39 UTSW 3 33,869,609 (GRCm39) unclassified probably benign
R9207:Ccdc39 UTSW 3 33,886,706 (GRCm39) nonsense probably null
R9280:Ccdc39 UTSW 3 33,870,153 (GRCm39) missense probably damaging 0.98
R9462:Ccdc39 UTSW 3 33,868,519 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGTTCTAACCCGTTCTGAAAG -3'
(R):5'- GCTGACGACCTCTTAAAGCTG -3'

Sequencing Primer
(F):5'- GTCATCAGTCCTACACAGTTTACAAG -3'
(R):5'- TGACCCTAATCCTCACATCTCTGAAG -3'
Posted On 2019-06-26