Incidental Mutation 'R7183:Tnc'
ID 559100
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Name tenascin C
Synonyms cytotactin, C130033P17Rik, TN-C, hexabrachion, tenascin-C, Hxb, TN
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 63878022-63965252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63931365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 782 (S782P)
Ref Sequence ENSEMBL: ENSMUSP00000030056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]
AlphaFold Q80YX1
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: S782P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: S782P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107371
AA Change: S782P

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364
AA Change: S782P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
Pfam:hEGF 173 185 4e-4 PFAM
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: S782P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: S782P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: S782P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: S782P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 63,935,061 (GRCm39) splice site probably benign
IGL00531:Tnc APN 4 63,889,390 (GRCm39) splice site probably benign
IGL00674:Tnc APN 4 63,883,844 (GRCm39) missense probably damaging 1.00
IGL01015:Tnc APN 4 63,935,571 (GRCm39) missense probably benign 0.19
IGL01090:Tnc APN 4 63,918,317 (GRCm39) missense probably damaging 1.00
IGL01310:Tnc APN 4 63,931,314 (GRCm39) missense probably benign 0.03
IGL01331:Tnc APN 4 63,901,112 (GRCm39) missense probably damaging 0.99
IGL01393:Tnc APN 4 63,932,291 (GRCm39) splice site probably benign
IGL01411:Tnc APN 4 63,918,959 (GRCm39) missense probably damaging 0.96
IGL01472:Tnc APN 4 63,924,656 (GRCm39) missense probably benign 0.00
IGL01552:Tnc APN 4 63,888,645 (GRCm39) missense probably damaging 1.00
IGL01661:Tnc APN 4 63,888,544 (GRCm39) splice site probably benign
IGL01669:Tnc APN 4 63,918,938 (GRCm39) missense probably damaging 1.00
IGL01912:Tnc APN 4 63,926,977 (GRCm39) missense probably damaging 1.00
IGL02028:Tnc APN 4 63,884,909 (GRCm39) splice site probably benign
IGL02100:Tnc APN 4 63,918,398 (GRCm39) missense possibly damaging 0.84
IGL02549:Tnc APN 4 63,933,309 (GRCm39) missense probably damaging 1.00
IGL02642:Tnc APN 4 63,883,816 (GRCm39) splice site probably benign
IGL02712:Tnc APN 4 63,893,493 (GRCm39) missense probably damaging 1.00
IGL02876:Tnc APN 4 63,933,338 (GRCm39) missense possibly damaging 0.56
IGL02886:Tnc APN 4 63,918,344 (GRCm39) missense probably damaging 0.96
IGL02972:Tnc APN 4 63,894,715 (GRCm39) missense probably benign 0.11
IGL03073:Tnc APN 4 63,889,461 (GRCm39) missense possibly damaging 0.58
IGL03116:Tnc APN 4 63,932,270 (GRCm39) missense probably damaging 1.00
IGL03181:Tnc APN 4 63,885,543 (GRCm39) missense possibly damaging 0.95
IGL03358:Tnc APN 4 63,935,852 (GRCm39) nonsense probably null
tancredo UTSW 4 63,911,534 (GRCm39) nonsense probably null
BB009:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
BB019:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
P0020:Tnc UTSW 4 63,927,094 (GRCm39) missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 63,935,973 (GRCm39) missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
R0243:Tnc UTSW 4 63,888,657 (GRCm39) missense probably damaging 0.98
R0362:Tnc UTSW 4 63,935,679 (GRCm39) missense probably damaging 1.00
R0410:Tnc UTSW 4 63,925,931 (GRCm39) missense probably benign 0.00
R0420:Tnc UTSW 4 63,918,396 (GRCm39) missense probably benign 0.00
R0540:Tnc UTSW 4 63,938,692 (GRCm39) missense probably damaging 1.00
R0650:Tnc UTSW 4 63,926,971 (GRCm39) missense probably benign 0.00
R1019:Tnc UTSW 4 63,880,319 (GRCm39) missense probably damaging 1.00
R1102:Tnc UTSW 4 63,938,705 (GRCm39) missense probably benign 0.05
R1126:Tnc UTSW 4 63,936,357 (GRCm39) missense probably damaging 0.99
R1141:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1142:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1307:Tnc UTSW 4 63,927,096 (GRCm39) missense probably damaging 0.98
R1322:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1414:Tnc UTSW 4 63,883,932 (GRCm39) splice site probably benign
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1499:Tnc UTSW 4 63,882,991 (GRCm39) missense probably benign 0.15
R1506:Tnc UTSW 4 63,925,921 (GRCm39) missense possibly damaging 0.90
R1597:Tnc UTSW 4 63,924,621 (GRCm39) missense probably benign
R1750:Tnc UTSW 4 63,890,972 (GRCm39) missense probably damaging 1.00
R1765:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1783:Tnc UTSW 4 63,936,333 (GRCm39) missense probably damaging 0.98
R1808:Tnc UTSW 4 63,918,168 (GRCm39) missense probably damaging 1.00
R1903:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.00
R1932:Tnc UTSW 4 63,911,262 (GRCm39) critical splice donor site probably null
R1941:Tnc UTSW 4 63,933,201 (GRCm39) missense probably damaging 1.00
R1983:Tnc UTSW 4 63,902,867 (GRCm39) missense possibly damaging 0.95
R2024:Tnc UTSW 4 63,882,858 (GRCm39) missense probably damaging 1.00
R2075:Tnc UTSW 4 63,913,903 (GRCm39) missense possibly damaging 0.94
R2327:Tnc UTSW 4 63,893,475 (GRCm39) missense possibly damaging 0.78
R2444:Tnc UTSW 4 63,933,200 (GRCm39) missense probably damaging 1.00
R2982:Tnc UTSW 4 63,938,756 (GRCm39) missense possibly damaging 0.81
R3874:Tnc UTSW 4 63,926,947 (GRCm39) missense probably damaging 1.00
R4110:Tnc UTSW 4 63,933,188 (GRCm39) missense probably damaging 1.00
R4360:Tnc UTSW 4 63,935,161 (GRCm39) missense probably benign 0.35
R4371:Tnc UTSW 4 63,888,588 (GRCm39) missense probably damaging 1.00
R4434:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4438:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4570:Tnc UTSW 4 63,913,909 (GRCm39) missense probably damaging 0.99
R4595:Tnc UTSW 4 63,913,982 (GRCm39) missense probably damaging 1.00
R4749:Tnc UTSW 4 63,913,876 (GRCm39) missense possibly damaging 0.56
R4756:Tnc UTSW 4 63,885,580 (GRCm39) missense probably damaging 0.99
R4824:Tnc UTSW 4 63,935,857 (GRCm39) nonsense probably null
R4957:Tnc UTSW 4 63,894,793 (GRCm39) missense probably damaging 1.00
R4977:Tnc UTSW 4 63,924,485 (GRCm39) missense possibly damaging 0.82
R5001:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.16
R5001:Tnc UTSW 4 63,902,726 (GRCm39) missense probably damaging 1.00
R5015:Tnc UTSW 4 63,924,739 (GRCm39) missense probably damaging 1.00
R5049:Tnc UTSW 4 63,936,223 (GRCm39) missense probably damaging 1.00
R5066:Tnc UTSW 4 63,893,466 (GRCm39) missense probably damaging 0.96
R5073:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R5116:Tnc UTSW 4 63,885,452 (GRCm39) critical splice donor site probably null
R5195:Tnc UTSW 4 63,885,489 (GRCm39) missense probably damaging 1.00
R5200:Tnc UTSW 4 63,889,515 (GRCm39) missense probably damaging 1.00
R5221:Tnc UTSW 4 63,911,534 (GRCm39) nonsense probably null
R5237:Tnc UTSW 4 63,880,333 (GRCm39) missense probably damaging 1.00
R5265:Tnc UTSW 4 63,911,443 (GRCm39) missense probably benign 0.00
R5275:Tnc UTSW 4 63,882,967 (GRCm39) nonsense probably null
R5346:Tnc UTSW 4 63,926,892 (GRCm39) missense probably benign
R5409:Tnc UTSW 4 63,925,654 (GRCm39) missense probably damaging 1.00
R5409:Tnc UTSW 4 63,884,773 (GRCm39) missense probably damaging 1.00
R5469:Tnc UTSW 4 63,932,162 (GRCm39) splice site probably null
R5518:Tnc UTSW 4 63,935,916 (GRCm39) missense probably damaging 1.00
R5560:Tnc UTSW 4 63,926,946 (GRCm39) missense probably damaging 1.00
R5588:Tnc UTSW 4 63,924,659 (GRCm39) missense possibly damaging 0.57
R5686:Tnc UTSW 4 63,925,967 (GRCm39) splice site probably null
R5686:Tnc UTSW 4 63,927,032 (GRCm39) missense possibly damaging 0.78
R5837:Tnc UTSW 4 63,931,451 (GRCm39) missense probably damaging 1.00
R5976:Tnc UTSW 4 63,936,403 (GRCm39) missense probably benign 0.17
R6156:Tnc UTSW 4 63,888,589 (GRCm39) missense probably damaging 1.00
R6182:Tnc UTSW 4 63,927,033 (GRCm39) missense probably damaging 0.99
R6360:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R6416:Tnc UTSW 4 63,926,053 (GRCm39) missense probably benign 0.05
R6778:Tnc UTSW 4 63,913,835 (GRCm39) missense probably benign 0.12
R6798:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6799:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6943:Tnc UTSW 4 63,900,982 (GRCm39) missense probably damaging 0.97
R7027:Tnc UTSW 4 63,902,826 (GRCm39) missense probably benign 0.02
R7204:Tnc UTSW 4 63,889,392 (GRCm39) splice site probably null
R7317:Tnc UTSW 4 63,890,959 (GRCm39) missense probably damaging 0.99
R7323:Tnc UTSW 4 63,889,469 (GRCm39) missense probably damaging 0.96
R7327:Tnc UTSW 4 63,882,999 (GRCm39) splice site probably null
R7382:Tnc UTSW 4 63,932,280 (GRCm39) nonsense probably null
R7399:Tnc UTSW 4 63,938,894 (GRCm39) start gained probably benign
R7479:Tnc UTSW 4 63,935,865 (GRCm39) missense possibly damaging 0.95
R7585:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R7932:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
R7947:Tnc UTSW 4 63,935,580 (GRCm39) missense probably damaging 1.00
R7974:Tnc UTSW 4 63,918,961 (GRCm39) missense possibly damaging 0.84
R7991:Tnc UTSW 4 63,926,983 (GRCm39) missense probably benign 0.42
R8004:Tnc UTSW 4 63,902,894 (GRCm39) missense probably benign 0.04
R8080:Tnc UTSW 4 63,894,706 (GRCm39) missense possibly damaging 0.52
R8109:Tnc UTSW 4 63,927,000 (GRCm39) missense probably benign 0.11
R8145:Tnc UTSW 4 63,935,716 (GRCm39) missense probably benign
R8340:Tnc UTSW 4 63,926,036 (GRCm39) missense probably damaging 1.00
R8360:Tnc UTSW 4 63,885,511 (GRCm39) missense probably benign 0.00
R8671:Tnc UTSW 4 63,935,683 (GRCm39) missense probably damaging 1.00
R8691:Tnc UTSW 4 63,880,313 (GRCm39) missense probably damaging 1.00
R8759:Tnc UTSW 4 63,924,501 (GRCm39) missense possibly damaging 0.86
R8864:Tnc UTSW 4 63,911,296 (GRCm39) missense probably damaging 0.98
R8927:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8928:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8949:Tnc UTSW 4 63,927,087 (GRCm39) missense probably damaging 1.00
R8956:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R9016:Tnc UTSW 4 63,935,331 (GRCm39) missense probably benign 0.23
R9049:Tnc UTSW 4 63,918,247 (GRCm39) missense possibly damaging 0.83
R9097:Tnc UTSW 4 63,888,622 (GRCm39) missense possibly damaging 0.62
R9114:Tnc UTSW 4 63,890,973 (GRCm39) missense probably benign 0.03
R9151:Tnc UTSW 4 63,938,686 (GRCm39) missense possibly damaging 0.46
R9488:Tnc UTSW 4 63,913,942 (GRCm39) missense probably damaging 0.99
R9537:Tnc UTSW 4 63,884,821 (GRCm39) missense probably damaging 0.99
R9666:Tnc UTSW 4 63,926,045 (GRCm39) missense probably damaging 1.00
R9700:Tnc UTSW 4 63,933,186 (GRCm39) missense probably damaging 0.99
R9703:Tnc UTSW 4 63,889,412 (GRCm39) missense probably benign 0.00
R9771:Tnc UTSW 4 63,925,600 (GRCm39) missense probably damaging 1.00
S24628:Tnc UTSW 4 63,936,249 (GRCm39) missense probably damaging 1.00
Z1177:Tnc UTSW 4 63,925,663 (GRCm39) nonsense probably null
Z1177:Tnc UTSW 4 63,878,781 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCATATGGACTTTGTATTGGTAAGC -3'
(R):5'- AATCTGCTGGGCTACATAGGAG -3'

Sequencing Primer
(F):5'- GCAAATTCTCACTGATGCAGATGC -3'
(R):5'- CTGGGCTACATAGGAGGGTAC -3'
Posted On 2019-06-26