Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Masp2'

559103

Institutional Source

Beutler Lab

Gene Symbol

Masp2

Ensembl Gene

ENSMUSG00000028979

Gene Name

mannan-binding lectin serine peptidase 2

Synonyms

MASP-2, MAp19

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148602554-148615499 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148612157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 404 (S404G)

Ref Sequence

ENSEMBL: ENSMUSP00000049729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045180] [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000105699] [ENSMUST00000105702] [ENSMUST00000140897] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000186711] [ENSMUST00000186729] [ENSMUST00000187939] [ENSMUST00000188134] [ENSMUST00000190552] [ENSMUST00000191450]

AlphaFold

Q91WP0

Predicted Effect

probably benign
Transcript: ENSMUST00000045180

SMART Domains

Protein: ENSMUSP00000038113
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052060
AA Change: S404G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979
AA Change: S404G

Domain	Start	End	E-Value	Type
CUB	18	137	4.71e-30	SMART
EGF_CA	138	181	4.32e-10	SMART
CUB	184	296	4.29e-33	SMART
CCP	300	361	1.79e-12	SMART
CCP	366	429	5.4e-7	SMART
Tryp_SPc	443	678	1.3e-82	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084125

SMART Domains

Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART
low complexity region	273	316	N/A	INTRINSIC
low complexity region	321	329	N/A	INTRINSIC
low complexity region	342	358	N/A	INTRINSIC
low complexity region	368	380	N/A	INTRINSIC
low complexity region	386	404	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105699

SMART Domains

Protein: ENSMUSP00000101324
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105702

SMART Domains

Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140897

SMART Domains

Protein: ENSMUSP00000135135
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
Blast:RRM_2	1	28	2e-13	BLAST
RRM	44	110	3e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147391

Predicted Effect

probably benign
Transcript: ENSMUST00000165113

SMART Domains

Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172073

SMART Domains

Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART
low complexity region	274	285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186711

Predicted Effect

probably benign
Transcript: ENSMUST00000186729

SMART Domains

Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
Pfam:RRM_1	1	37	1.8e-4	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000187939

SMART Domains

Protein: ENSMUSP00000140928
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	18	84	3e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188134

SMART Domains

Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	1.38e-17	SMART
RRM	192	258	7.03e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188488

Predicted Effect

probably benign
Transcript: ENSMUST00000190287

Predicted Effect

probably benign
Transcript: ENSMUST00000190552

SMART Domains

Protein: ENSMUSP00000141052
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM_2	1	56	6.1e-4	SMART
RRM	72	138	3e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191378

Predicted Effect

probably benign
Transcript: ENSMUST00000191450

SMART Domains

Protein: ENSMUSP00000140832
Gene: ENSMUSG00000041459

Domain	Start	End	E-Value	Type
RRM	105	176	5.8e-20	SMART
RRM	192	258	3e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Masp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Masp2	APN	4	148602729	missense	probably benign	0.05
IGL01284:Masp2	APN	4	148614007	missense	probably damaging	1.00
IGL02040:Masp2	APN	4	148603813	missense	probably damaging	1.00
IGL02243:Masp2	APN	4	148603068	missense	probably benign	0.32
IGL02490:Masp2	APN	4	148607943	missense	possibly damaging	0.91
IGL02517:Masp2	APN	4	148614020	missense	probably damaging	1.00
IGL02997:Masp2	APN	4	148603175	splice site	probably benign
R0408:Masp2	UTSW	4	148606039	missense	probably benign
R1517:Masp2	UTSW	4	148612106	missense	possibly damaging	0.74
R1630:Masp2	UTSW	4	148614033	missense	probably benign	0.07
R1634:Masp2	UTSW	4	148614355	missense	probably damaging	1.00
R1873:Masp2	UTSW	4	148614495	missense	probably damaging	1.00
R2208:Masp2	UTSW	4	148614415	missense	probably damaging	1.00
R2283:Masp2	UTSW	4	148606068	missense	probably benign	0.00
R2876:Masp2	UTSW	4	148608001	missense	probably benign
R3921:Masp2	UTSW	4	148605731	missense	possibly damaging	0.95
R4586:Masp2	UTSW	4	148613901	missense	probably damaging	1.00
R4753:Masp2	UTSW	4	148612151	missense	probably benign	0.00
R4877:Masp2	UTSW	4	148602871	missense	probably benign	0.00
R5169:Masp2	UTSW	4	148606114	missense	probably damaging	0.96
R5512:Masp2	UTSW	4	148614069	missense	probably damaging	1.00
R6161:Masp2	UTSW	4	148614012	missense	possibly damaging	0.88
R6291:Masp2	UTSW	4	148602753	missense	probably damaging	0.99
R7039:Masp2	UTSW	4	148602586	start codon destroyed	probably benign	0.03
R7164:Masp2	UTSW	4	148610115	critical splice acceptor site	probably null
R7417:Masp2	UTSW	4	148605721	missense	probably benign	0.02
R7718:Masp2	UTSW	4	148602747	missense	probably damaging	1.00
R7748:Masp2	UTSW	4	148605706	missense	probably benign	0.00
R7852:Masp2	UTSW	4	148602732	missense	probably benign	0.00
R7986:Masp2	UTSW	4	148602826	missense	probably damaging	1.00
R8078:Masp2	UTSW	4	148613778	missense	probably benign	0.01
R8203:Masp2	UTSW	4	148612142	missense	probably benign	0.00
R8257:Masp2	UTSW	4	148603040	missense	possibly damaging	0.82
R8465:Masp2	UTSW	4	148612059	missense	possibly damaging	0.79
R9324:Masp2	UTSW	4	148608028	missense	possibly damaging	0.65
R9350:Masp2	UTSW	4	148607939	critical splice acceptor site	probably null
R9706:Masp2	UTSW	4	148612140	missense	probably benign	0.03
X0025:Masp2	UTSW	4	148602723	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATCAGCTCCAAGGTACAAAGGG -3'
(R):5'- GCTTGCAAAGTGGAAACCTTTTAG -3'

Sequencing Primer
(F):5'- GCTCCAAGGTACAAAGGGATCCC -3'
(R):5'- GCAAAGTGGAAACCTTTTAGATGTG -3'

Posted On

2019-06-26