Incidental Mutation 'R7183:Crmp1'
ID 559104
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Name collapsin response mediator protein 1
Synonyms Ulip3, DRP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 37241940-37292133 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37288817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 606 (H606N)
Ref Sequence ENSEMBL: ENSMUSP00000109795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114154] [ENSMUST00000114158]
AlphaFold P97427
Predicted Effect probably benign
Transcript: ENSMUST00000031004
AA Change: H492N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121
AA Change: H492N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114154
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114158
AA Change: H606N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121
AA Change: H606N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37276313 missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37278855 splice site probably benign
IGL02904:Crmp1 APN 5 37288918 missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37284080 missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37286426 missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37265289 missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37265313 missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37273434 missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37288811 missense probably benign 0.14
R1651:Crmp1 UTSW 5 37273439 missense probably damaging 0.97
R1653:Crmp1 UTSW 5 37286468 missense probably damaging 1.00
R1951:Crmp1 UTSW 5 37273355 missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37276283 missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37242494 missense probably benign 0.04
R2295:Crmp1 UTSW 5 37265262 missense probably benign
R2495:Crmp1 UTSW 5 37246097 critical splice donor site probably null
R3417:Crmp1 UTSW 5 37268687 missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37284140 missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37276331 missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37279674 missense probably benign 0.16
R5592:Crmp1 UTSW 5 37265265 missense probably benign 0.09
R5761:Crmp1 UTSW 5 37282868 missense probably benign 0.15
R6243:Crmp1 UTSW 5 37288944 missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37284064 missense probably benign 0.04
R6750:Crmp1 UTSW 5 37265322 critical splice donor site probably null
R7013:Crmp1 UTSW 5 37268692 splice site probably null
R7360:Crmp1 UTSW 5 37276280 missense possibly damaging 0.95
R7419:Crmp1 UTSW 5 37278885 missense probably benign 0.03
R7792:Crmp1 UTSW 5 37284095 missense probably damaging 1.00
R8427:Crmp1 UTSW 5 37291195 missense probably damaging 1.00
R8479:Crmp1 UTSW 5 37284158 missense possibly damaging 0.59
R8762:Crmp1 UTSW 5 37284096 missense probably damaging 1.00
R8993:Crmp1 UTSW 5 37242146 start codon destroyed probably null 0.68
R9027:Crmp1 UTSW 5 37280603 nonsense probably null
R9477:Crmp1 UTSW 5 37288838 missense probably damaging 1.00
R9778:Crmp1 UTSW 5 37265275 missense probably benign 0.32
Z1177:Crmp1 UTSW 5 37278124 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGTCCTTGATTCTGGTGCC -3'
(R):5'- GGCTTCCATGAGACTACCTG -3'

Sequencing Primer
(F):5'- CCCTGTGTACTCTGTAAAGATGAGAC -3'
(R):5'- GGCTTCCATGAGACTACCTGATAAG -3'
Posted On 2019-06-26