Incidental Mutation 'R7183:Crmp1'
ID 559104
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Name collapsin response mediator protein 1
Synonyms Ulip3, DRP-1
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.391) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 37399402-37449507 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37446161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 606 (H606N)
Ref Sequence ENSEMBL: ENSMUSP00000109795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114154] [ENSMUST00000114158]
AlphaFold P97427
Predicted Effect probably benign
Transcript: ENSMUST00000031004
AA Change: H492N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121
AA Change: H492N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114154
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114158
AA Change: H606N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121
AA Change: H606N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37,433,657 (GRCm39) missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37,436,199 (GRCm39) splice site probably benign
IGL02904:Crmp1 APN 5 37,446,262 (GRCm39) missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37,441,424 (GRCm39) missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37,443,770 (GRCm39) missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37,422,633 (GRCm39) missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37,422,617 (GRCm39) missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37,422,617 (GRCm39) missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37,441,479 (GRCm39) missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37,441,479 (GRCm39) missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37,422,657 (GRCm39) missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37,430,778 (GRCm39) missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37,446,155 (GRCm39) missense probably benign 0.14
R1651:Crmp1 UTSW 5 37,430,783 (GRCm39) missense probably damaging 0.97
R1653:Crmp1 UTSW 5 37,443,812 (GRCm39) missense probably damaging 1.00
R1951:Crmp1 UTSW 5 37,430,699 (GRCm39) missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37,433,627 (GRCm39) missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37,399,838 (GRCm39) missense probably benign 0.04
R2295:Crmp1 UTSW 5 37,422,606 (GRCm39) missense probably benign
R2495:Crmp1 UTSW 5 37,403,441 (GRCm39) critical splice donor site probably null
R3417:Crmp1 UTSW 5 37,426,031 (GRCm39) missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37,441,484 (GRCm39) missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37,433,675 (GRCm39) missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37,437,018 (GRCm39) missense probably benign 0.16
R5592:Crmp1 UTSW 5 37,422,609 (GRCm39) missense probably benign 0.09
R5761:Crmp1 UTSW 5 37,440,212 (GRCm39) missense probably benign 0.15
R6243:Crmp1 UTSW 5 37,446,288 (GRCm39) missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37,441,408 (GRCm39) missense probably benign 0.04
R6750:Crmp1 UTSW 5 37,422,666 (GRCm39) critical splice donor site probably null
R7013:Crmp1 UTSW 5 37,426,036 (GRCm39) splice site probably null
R7360:Crmp1 UTSW 5 37,433,624 (GRCm39) missense possibly damaging 0.95
R7419:Crmp1 UTSW 5 37,436,229 (GRCm39) missense probably benign 0.03
R7792:Crmp1 UTSW 5 37,441,439 (GRCm39) missense probably damaging 1.00
R8427:Crmp1 UTSW 5 37,448,539 (GRCm39) missense probably damaging 1.00
R8479:Crmp1 UTSW 5 37,441,502 (GRCm39) missense possibly damaging 0.59
R8762:Crmp1 UTSW 5 37,441,440 (GRCm39) missense probably damaging 1.00
R8993:Crmp1 UTSW 5 37,399,490 (GRCm39) start codon destroyed probably null 0.68
R9027:Crmp1 UTSW 5 37,437,947 (GRCm39) nonsense probably null
R9477:Crmp1 UTSW 5 37,446,182 (GRCm39) missense probably damaging 1.00
R9778:Crmp1 UTSW 5 37,422,619 (GRCm39) missense probably benign 0.32
Z1177:Crmp1 UTSW 5 37,435,468 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGTCCTTGATTCTGGTGCC -3'
(R):5'- GGCTTCCATGAGACTACCTG -3'

Sequencing Primer
(F):5'- CCCTGTGTACTCTGTAAAGATGAGAC -3'
(R):5'- GGCTTCCATGAGACTACCTGATAAG -3'
Posted On 2019-06-26