Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Crmp1'

559104

Institutional Source

Beutler Lab

Gene Symbol

Crmp1

Ensembl Gene

ENSMUSG00000029121

Gene Name

collapsin response mediator protein 1

Synonyms

Ulip3, DRP-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.372) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37241940-37292133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 37288817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 606 (H606N)

Ref Sequence

ENSEMBL: ENSMUSP00000109795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114154] [ENSMUST00000114158]

AlphaFold

P97427

Predicted Effect

probably benign
Transcript: ENSMUST00000031004
AA Change: H492N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121
AA Change: H492N

Domain	Start	End	E-Value	Type
Pfam:Amidohydro_1	64	453	9.1e-35	PFAM
Pfam:Amidohydro_3	333	454	8.5e-10	PFAM
low complexity region	507	530	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114154

SMART Domains

Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122

Domain	Start	End	E-Value	Type
low complexity region	272	295	N/A	INTRINSIC
low complexity region	463	475	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
coiled coil region	517	548	N/A	INTRINSIC
low complexity region	595	609	N/A	INTRINSIC
coiled coil region	694	734	N/A	INTRINSIC
low complexity region	750	767	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114158
AA Change: H606N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121
AA Change: H606N

Domain	Start	End	E-Value	Type
Pfam:Amidohydro_1	178	567	5.2e-34	PFAM
Pfam:Amidohydro_3	448	568	2.8e-10	PFAM
low complexity region	621	644	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Crmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Crmp1	APN	5	37276313	missense	probably damaging	0.99
IGL02506:Crmp1	APN	5	37278855	splice site	probably benign
IGL02904:Crmp1	APN	5	37288918	missense	possibly damaging	0.80
IGL02946:Crmp1	APN	5	37284080	missense	probably damaging	1.00
IGL02981:Crmp1	APN	5	37286426	missense	probably damaging	0.97
IGL03068:Crmp1	APN	5	37265289	missense	possibly damaging	0.69
R0049:Crmp1	UTSW	5	37265273	missense	possibly damaging	0.52
R0049:Crmp1	UTSW	5	37265273	missense	possibly damaging	0.52
R0105:Crmp1	UTSW	5	37284135	missense	probably damaging	1.00
R0105:Crmp1	UTSW	5	37284135	missense	probably damaging	1.00
R0331:Crmp1	UTSW	5	37265313	missense	possibly damaging	0.79
R1226:Crmp1	UTSW	5	37273434	missense	probably damaging	1.00
R1372:Crmp1	UTSW	5	37288811	missense	probably benign	0.14
R1651:Crmp1	UTSW	5	37273439	missense	probably damaging	0.97
R1653:Crmp1	UTSW	5	37286468	missense	probably damaging	1.00
R1951:Crmp1	UTSW	5	37273355	missense	possibly damaging	0.81
R1977:Crmp1	UTSW	5	37276283	missense	probably damaging	1.00
R2107:Crmp1	UTSW	5	37242494	missense	probably benign	0.04
R2295:Crmp1	UTSW	5	37265262	missense	probably benign
R2495:Crmp1	UTSW	5	37246097	critical splice donor site	probably null
R3417:Crmp1	UTSW	5	37268687	missense	possibly damaging	0.48
R3788:Crmp1	UTSW	5	37284140	missense	probably damaging	1.00
R4490:Crmp1	UTSW	5	37276331	missense	probably damaging	0.99
R5338:Crmp1	UTSW	5	37279674	missense	probably benign	0.16
R5592:Crmp1	UTSW	5	37265265	missense	probably benign	0.09
R5761:Crmp1	UTSW	5	37282868	missense	probably benign	0.15
R6243:Crmp1	UTSW	5	37288944	missense	probably damaging	1.00
R6726:Crmp1	UTSW	5	37284064	missense	probably benign	0.04
R6750:Crmp1	UTSW	5	37265322	critical splice donor site	probably null
R7013:Crmp1	UTSW	5	37268692	splice site	probably null
R7360:Crmp1	UTSW	5	37276280	missense	possibly damaging	0.95
R7419:Crmp1	UTSW	5	37278885	missense	probably benign	0.03
R7792:Crmp1	UTSW	5	37284095	missense	probably damaging	1.00
R8427:Crmp1	UTSW	5	37291195	missense	probably damaging	1.00
R8479:Crmp1	UTSW	5	37284158	missense	possibly damaging	0.59
R8762:Crmp1	UTSW	5	37284096	missense	probably damaging	1.00
R8993:Crmp1	UTSW	5	37242146	start codon destroyed	probably null	0.68
R9027:Crmp1	UTSW	5	37280603	nonsense	probably null
R9477:Crmp1	UTSW	5	37288838	missense	probably damaging	1.00
R9778:Crmp1	UTSW	5	37265275	missense	probably benign	0.32
Z1177:Crmp1	UTSW	5	37278124	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAAGTCCTTGATTCTGGTGCC -3'
(R):5'- GGCTTCCATGAGACTACCTG -3'

Sequencing Primer
(F):5'- CCCTGTGTACTCTGTAAAGATGAGAC -3'
(R):5'- GGCTTCCATGAGACTACCTGATAAG -3'

Posted On

2019-06-26