Mutagenetix > Incidental Mutations

Incidental Mutation 'R7183:Vps33a'

559105

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123535215 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 436 (Q436R)

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388] [ENSMUST00000031388]

Predicted Effect

probably null
Transcript: ENSMUST00000031388
AA Change: Q436R

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: Q436R

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000031388
AA Change: Q436R

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: Q436R

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCATGCTGCCAAGTTACGAC -3'
(R):5'- CAGAGACATCAAGTGGACTGGTTAG -3'

Sequencing Primer
(F):5'- GGAACTTTCTCTGTAGACCAGGC -3'
(R):5'- GTCTGTTCATATTCCATTTCTAGGTC -3'

Posted On

2019-06-26