Incidental Mutation 'R0590:Olfr1130'
ID55911
Institutional Source Beutler Lab
Gene Symbol Olfr1130
Ensembl Gene ENSMUSG00000059205
Gene Nameolfactory receptor 1130
SynonymsMOR264-4, GA_x6K02T2Q125-49112575-49113519
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87606212-87609852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87607994 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 202 (E202G)
Ref Sequence ENSEMBL: ENSMUSP00000078649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000213103] [ENSMUST00000216580]
Predicted Effect probably damaging
Transcript: ENSMUST00000079711
AA Change: E202G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: E202G

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213103
AA Change: E202G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216580
AA Change: E202G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.3674 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Olfr1130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Olfr1130 APN 2 87607979 missense probably damaging 1.00
IGL01310:Olfr1130 APN 2 87607508 missense possibly damaging 0.68
IGL02558:Olfr1130 APN 2 87607559 missense probably benign 0.00
R0323:Olfr1130 UTSW 2 87607497 missense probably benign
R0718:Olfr1130 UTSW 2 87607927 missense probably benign 0.08
R2445:Olfr1130 UTSW 2 87607958 missense probably damaging 0.99
R3408:Olfr1130 UTSW 2 87607876 missense probably benign 0.03
R4280:Olfr1130 UTSW 2 87608251 missense possibly damaging 0.90
R4491:Olfr1130 UTSW 2 87607392 start codon destroyed probably null 0.84
R4928:Olfr1130 UTSW 2 87608143 missense probably benign 0.06
R5033:Olfr1130 UTSW 2 87607711 missense probably damaging 1.00
R5061:Olfr1130 UTSW 2 87607832 missense probably benign 0.00
R5109:Olfr1130 UTSW 2 87607411 missense possibly damaging 0.64
R5109:Olfr1130 UTSW 2 87607975 missense possibly damaging 0.78
R5772:Olfr1130 UTSW 2 87608173 missense probably benign 0.12
R6004:Olfr1130 UTSW 2 87607909 missense probably damaging 1.00
R6005:Olfr1130 UTSW 2 87608080 missense probably damaging 0.97
R6411:Olfr1130 UTSW 2 87607973 missense probably damaging 1.00
R6964:Olfr1130 UTSW 2 87607613 missense probably damaging 1.00
R7085:Olfr1130 UTSW 2 87607406 missense probably benign 0.00
R7484:Olfr1130 UTSW 2 87607937 missense probably damaging 1.00
X0060:Olfr1130 UTSW 2 87608042 missense probably benign 0.11
Z1176:Olfr1130 UTSW 2 87607754 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTGCTGGCTGTGATGTCTTATGACC -3'
(R):5'- AGTGCAGCAATCACCTCCTTGTTTC -3'

Sequencing Primer
(F):5'- TTGGTCATGAACCCAACAAAGTG -3'
(R):5'- GACTTTGGCCTCAAGTAGGTAATAG -3'
Posted On2013-07-11