Incidental Mutation 'R7183:Chst4'
ID 559113
Institutional Source Beutler Lab
Gene Symbol Chst4
Ensembl Gene ENSMUSG00000035930
Gene Name carbohydrate sulfotransferase 4
Synonyms GST-3, HEC-GlcNAc6ST, high endothelial cell GlcNAC-6-sulphotransferase
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110755707-110766033 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110756630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 411 (N411S)
Ref Sequence ENSEMBL: ENSMUSP00000148741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109222] [ENSMUST00000211894] [ENSMUST00000212934]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109222
AA Change: N328S

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104845
Gene: ENSMUSG00000035930
AA Change: N328S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Sulfotransfer_3 41 296 6.4e-15 PFAM
Pfam:Sulfotransfer_1 41 357 2.4e-26 PFAM
low complexity region 370 378 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211894
AA Change: N411S

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000212934
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene do not accumulate lymphocytes in peripheral lymph nodes to as great an extent as normal. The animals are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Chst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Chst4 APN 8 110,756,597 (GRCm39) missense probably benign 0.14
A4554:Chst4 UTSW 8 110,756,520 (GRCm39) missense probably benign 0.09
R0091:Chst4 UTSW 8 110,757,297 (GRCm39) missense probably damaging 1.00
R0373:Chst4 UTSW 8 110,757,026 (GRCm39) missense probably damaging 1.00
R1171:Chst4 UTSW 8 110,757,255 (GRCm39) missense probably damaging 1.00
R1577:Chst4 UTSW 8 110,756,476 (GRCm39) missense probably benign 0.00
R2377:Chst4 UTSW 8 110,756,804 (GRCm39) missense possibly damaging 0.80
R3421:Chst4 UTSW 8 110,757,038 (GRCm39) missense probably damaging 1.00
R5514:Chst4 UTSW 8 110,756,606 (GRCm39) missense probably damaging 1.00
R6793:Chst4 UTSW 8 110,756,699 (GRCm39) missense probably damaging 1.00
R7141:Chst4 UTSW 8 110,757,471 (GRCm39) missense probably damaging 1.00
R7146:Chst4 UTSW 8 110,757,363 (GRCm39) missense probably damaging 1.00
R7732:Chst4 UTSW 8 110,756,514 (GRCm39) nonsense probably null
R7871:Chst4 UTSW 8 110,757,545 (GRCm39) missense probably damaging 1.00
R8493:Chst4 UTSW 8 110,757,095 (GRCm39) missense probably damaging 1.00
Z1176:Chst4 UTSW 8 110,756,724 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTGACTAAGGCTGGAACC -3'
(R):5'- CCTGTTCCTGAGGTATGAGGAC -3'

Sequencing Primer
(F):5'- GGGTGCAGACAGACCTCCTTAAC -3'
(R):5'- ATGAGGACCTGGTTCGGGC -3'
Posted On 2019-06-26