Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Arhgap32'

559116

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32116136-32268446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32186383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 228 (N228D)

Ref Sequence

ENSEMBL: ENSMUSP00000133898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000174641]

AlphaFold

Q811P8

Predicted Effect

probably benign
Transcript: ENSMUST00000174641
AA Change: N228D

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: N228D

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182310

Meta Mutation Damage Score

0.0756

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32257361	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32256964	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32260505	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32247190	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32259331	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32255648	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32247194	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32246006	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32261135	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32259134	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32259520	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32260856	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32151998	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32259760	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32246477	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32245255	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32258903	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32190068	splice site	probably benign
R0856:Arhgap32	UTSW	9	32260220	missense	probably damaging	1.00
R0990:Arhgap32	UTSW	9	32255381	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32255312	missense	probably benign
R1455:Arhgap32	UTSW	9	32260085	missense	probably benign	0.08
R1515:Arhgap32	UTSW	9	32116202	missense	probably benign
R1523:Arhgap32	UTSW	9	32256752	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32259800	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32259431	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32259911	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32239398	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32152019	splice site	probably null
R3793:Arhgap32	UTSW	9	32255373	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32190024	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32247066	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32247214	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32257474	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32259889	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32181839	splice site	probably null
R4587:Arhgap32	UTSW	9	32260945	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32259479	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32239348	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32170145	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4784:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4785:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4906:Arhgap32	UTSW	9	32245256	critical splice donor site	probably null
R5046:Arhgap32	UTSW	9	32256799	missense	probably damaging	1.00
R5360:Arhgap32	UTSW	9	32259671	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32152010	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32248382	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32247206	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32181960	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32255788	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32256979	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32260111	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32248488	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32152687	missense	possibly damaging	0.86
R7009:Arhgap32	UTSW	9	32245976	missense	probably damaging	1.00
R7137:Arhgap32	UTSW	9	32151936	missense	probably benign	0.32
R7251:Arhgap32	UTSW	9	32208185	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32152697	missense
R7289:Arhgap32	UTSW	9	32256937	missense	possibly damaging	0.92
R7289:Arhgap32	UTSW	9	32256938	missense	probably benign	0.02
R7391:Arhgap32	UTSW	9	32181939	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32245924	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32250722	missense	probably benign	0.10
R7584:Arhgap32	UTSW	9	32256967	missense	probably benign	0.16
R7653:Arhgap32	UTSW	9	32257145	missense	probably benign
R7884:Arhgap32	UTSW	9	32260514	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32257028	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32181854	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32247130	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32181900	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32256902	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32260909	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32255937	nonsense	probably null
R8696:Arhgap32	UTSW	9	32248503	missense	possibly damaging	0.90
R8832:Arhgap32	UTSW	9	32260819	missense	possibly damaging	0.94
R9112:Arhgap32	UTSW	9	32246013	missense	probably damaging	0.99
R9170:Arhgap32	UTSW	9	32250743	missense	possibly damaging	0.47
R9279:Arhgap32	UTSW	9	32257359	missense	probably benign	0.01
R9431:Arhgap32	UTSW	9	32259167	missense	probably damaging	1.00
R9522:Arhgap32	UTSW	9	32116154	missense	probably benign
R9526:Arhgap32	UTSW	9	32260730	missense	probably benign	0.28
R9661:Arhgap32	UTSW	9	32257235	missense	probably benign	0.01
X0027:Arhgap32	UTSW	9	32250641	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32261069	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32260680	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTGCCTAAGGATCTCTAGGTTTC -3'
(R):5'- GAGGCATTCTCAAATTGGTACC -3'

Sequencing Primer
(F):5'- CTTCCCTCTGGTTATGGTG -3'
(R):5'- CCATGTATAACTTCAGGTCCAGGG -3'

Posted On

2019-06-26