Incidental Mutation 'R7183:Arhgap32'
ID 559116
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene Name Rho GTPase activating protein 32
Synonyms p200RhoGAP, Grit, PX-RICS, GC-GAP, 3426406O18Rik
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 32027432-32179742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32097679 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 228 (N228D)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
AlphaFold Q811P8
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: N228D

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: N228D

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182310
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32,168,657 (GRCm39) missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32,168,260 (GRCm39) missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32,171,801 (GRCm39) missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32,158,486 (GRCm39) missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32,170,627 (GRCm39) missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32,166,944 (GRCm39) missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32,158,490 (GRCm39) missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32,157,302 (GRCm39) missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32,172,431 (GRCm39) missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32,170,430 (GRCm39) missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32,170,816 (GRCm39) missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32,172,152 (GRCm39) missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32,063,294 (GRCm39) missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32,171,056 (GRCm39) missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32,157,773 (GRCm39) missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32,156,551 (GRCm39) critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32,170,199 (GRCm39) missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32,101,364 (GRCm39) splice site probably benign
R0856:Arhgap32 UTSW 9 32,171,516 (GRCm39) missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32,166,677 (GRCm39) missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32,166,608 (GRCm39) missense probably benign
R1455:Arhgap32 UTSW 9 32,171,381 (GRCm39) missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32,027,498 (GRCm39) missense probably benign
R1523:Arhgap32 UTSW 9 32,168,048 (GRCm39) missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32,171,096 (GRCm39) missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32,170,727 (GRCm39) missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32,027,436 (GRCm39) missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32,171,207 (GRCm39) missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32,027,436 (GRCm39) missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32,158,793 (GRCm39) missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32,158,793 (GRCm39) missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32,150,694 (GRCm39) missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32,063,315 (GRCm39) splice site probably null
R3793:Arhgap32 UTSW 9 32,166,669 (GRCm39) missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32,101,320 (GRCm39) missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32,158,362 (GRCm39) unclassified probably benign
R4177:Arhgap32 UTSW 9 32,158,510 (GRCm39) missense probably null 1.00
R4230:Arhgap32 UTSW 9 32,168,770 (GRCm39) missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32,171,185 (GRCm39) missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32,093,135 (GRCm39) splice site probably null
R4587:Arhgap32 UTSW 9 32,172,241 (GRCm39) missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32,170,775 (GRCm39) missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32,150,644 (GRCm39) missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32,081,441 (GRCm39) missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32,172,076 (GRCm39) missense probably damaging 1.00
R4784:Arhgap32 UTSW 9 32,040,949 (GRCm39) missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32,040,949 (GRCm39) missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32,172,076 (GRCm39) missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32,156,552 (GRCm39) critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32,168,095 (GRCm39) missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32,170,967 (GRCm39) missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32,063,306 (GRCm39) missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32,159,678 (GRCm39) missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32,158,502 (GRCm39) missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32,093,256 (GRCm39) missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32,167,084 (GRCm39) missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32,168,275 (GRCm39) missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32,171,407 (GRCm39) missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32,159,784 (GRCm39) missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32,063,983 (GRCm39) missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32,157,272 (GRCm39) missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32,063,232 (GRCm39) missense probably benign 0.32
R7251:Arhgap32 UTSW 9 32,119,481 (GRCm39) missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32,063,993 (GRCm39) missense
R7289:Arhgap32 UTSW 9 32,168,234 (GRCm39) missense probably benign 0.02
R7289:Arhgap32 UTSW 9 32,168,233 (GRCm39) missense possibly damaging 0.92
R7391:Arhgap32 UTSW 9 32,093,235 (GRCm39) missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32,157,220 (GRCm39) missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32,162,018 (GRCm39) missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32,168,263 (GRCm39) missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32,168,441 (GRCm39) missense probably benign
R7884:Arhgap32 UTSW 9 32,171,810 (GRCm39) missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32,168,324 (GRCm39) missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32,093,150 (GRCm39) missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32,158,426 (GRCm39) missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32,093,196 (GRCm39) missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32,168,198 (GRCm39) missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32,172,205 (GRCm39) missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32,167,233 (GRCm39) nonsense probably null
R8696:Arhgap32 UTSW 9 32,159,799 (GRCm39) missense possibly damaging 0.90
R8832:Arhgap32 UTSW 9 32,172,115 (GRCm39) missense possibly damaging 0.94
R9112:Arhgap32 UTSW 9 32,157,309 (GRCm39) missense probably damaging 0.99
R9170:Arhgap32 UTSW 9 32,162,039 (GRCm39) missense possibly damaging 0.47
R9279:Arhgap32 UTSW 9 32,168,655 (GRCm39) missense probably benign 0.01
R9431:Arhgap32 UTSW 9 32,170,463 (GRCm39) missense probably damaging 1.00
R9522:Arhgap32 UTSW 9 32,027,450 (GRCm39) missense probably benign
R9526:Arhgap32 UTSW 9 32,172,026 (GRCm39) missense probably benign 0.28
R9661:Arhgap32 UTSW 9 32,168,531 (GRCm39) missense probably benign 0.01
X0027:Arhgap32 UTSW 9 32,161,937 (GRCm39) critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32,172,365 (GRCm39) missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32,171,976 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGCCTAAGGATCTCTAGGTTTC -3'
(R):5'- GAGGCATTCTCAAATTGGTACC -3'

Sequencing Primer
(F):5'- CTTCCCTCTGGTTATGGTG -3'
(R):5'- CCATGTATAACTTCAGGTCCAGGG -3'
Posted On 2019-06-26