Incidental Mutation 'R7183:P4htm'
ID 559118
Institutional Source Beutler Lab
Gene Symbol P4htm
Ensembl Gene ENSMUSG00000006675
Gene Name prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms 4933406E20Rik, P4h-tm
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108456061-108474866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108459059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 291 (M291K)
Ref Sequence ENSEMBL: ENSMUSP00000006853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000068700] [ENSMUST00000193621]
AlphaFold Q8BG58
Predicted Effect possibly damaging
Transcript: ENSMUST00000006853
AA Change: M291K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675
AA Change: M291K

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192080
Predicted Effect probably benign
Transcript: ENSMUST00000193621
SMART Domains Protein: ENSMUSP00000141843
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Blast:P4Hc 143 211 5e-39 BLAST
Meta Mutation Damage Score 0.2793 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body weight, normal erythropoiesis, and cardioprotection after ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in P4htm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:P4htm APN 9 108,460,935 (GRCm39) missense probably damaging 1.00
IGL02205:P4htm APN 9 108,459,161 (GRCm39) missense probably benign 0.08
IGL02756:P4htm APN 9 108,456,977 (GRCm39) missense probably damaging 1.00
IGL02802:P4htm UTSW 9 108,460,055 (GRCm39) missense probably benign 0.00
R0605:P4htm UTSW 9 108,460,923 (GRCm39) missense probably null 0.17
R3922:P4htm UTSW 9 108,460,094 (GRCm39) missense probably benign
R4562:P4htm UTSW 9 108,459,195 (GRCm39) missense probably null 1.00
R4730:P4htm UTSW 9 108,456,971 (GRCm39) missense possibly damaging 0.89
R4900:P4htm UTSW 9 108,456,427 (GRCm39) missense probably damaging 1.00
R5027:P4htm UTSW 9 108,456,492 (GRCm39) missense probably benign 0.16
R5124:P4htm UTSW 9 108,459,141 (GRCm39) missense possibly damaging 0.59
R5633:P4htm UTSW 9 108,456,922 (GRCm39) missense probably damaging 1.00
R5877:P4htm UTSW 9 108,460,932 (GRCm39) missense possibly damaging 0.94
R5927:P4htm UTSW 9 108,474,582 (GRCm39) missense probably damaging 1.00
R6163:P4htm UTSW 9 108,459,150 (GRCm39) missense probably damaging 0.99
R6798:P4htm UTSW 9 108,460,117 (GRCm39) missense possibly damaging 0.83
R6920:P4htm UTSW 9 108,460,812 (GRCm39) missense probably benign 0.01
R6962:P4htm UTSW 9 108,456,394 (GRCm39) missense possibly damaging 0.49
R7066:P4htm UTSW 9 108,474,162 (GRCm39) missense probably damaging 0.98
R7376:P4htm UTSW 9 108,457,991 (GRCm39) missense probably damaging 0.98
R7506:P4htm UTSW 9 108,460,878 (GRCm39) missense probably damaging 1.00
R7533:P4htm UTSW 9 108,474,136 (GRCm39) missense probably benign 0.02
R7874:P4htm UTSW 9 108,474,148 (GRCm39) missense probably benign 0.01
R8453:P4htm UTSW 9 108,457,566 (GRCm39) unclassified probably benign
R8705:P4htm UTSW 9 108,457,240 (GRCm39) missense probably damaging 1.00
R9030:P4htm UTSW 9 108,474,627 (GRCm39) missense probably benign 0.16
R9099:P4htm UTSW 9 108,460,911 (GRCm39) missense probably benign 0.00
R9193:P4htm UTSW 9 108,460,081 (GRCm39) missense probably damaging 0.98
R9367:P4htm UTSW 9 108,459,147 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCAAGGGACAGGGATTCTCTG -3'
(R):5'- ACTGTGCTTCTCCACATTGG -3'

Sequencing Primer
(F):5'- ACTTGCTTTGTAGACCAGGC -3'
(R):5'- TCTCCACATTGGCCTGGCAG -3'
Posted On 2019-06-26