Incidental Mutation 'R0590:Nfatc2'
ID55912
Institutional Source Beutler Lab
Gene Symbol Nfatc2
Ensembl Gene ENSMUSG00000027544
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
SynonymsNFAT1-D, NFATp, NFAT1
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168476410-168601657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 168571199 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 169 (T169A)
Ref Sequence ENSEMBL: ENSMUSP00000118329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029057] [ENSMUST00000074618] [ENSMUST00000109184] [ENSMUST00000137451] [ENSMUST00000171689]
Predicted Effect probably benign
Transcript: ENSMUST00000029057
AA Change: T189A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029057
Gene: ENSMUSG00000027544
AA Change: T189A

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 2.6e-24 PFAM
Blast:IPT 579 618 8e-19 BLAST
SCOP:d1imhc1 579 619 3e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074618
AA Change: T189A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: T189A

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD_DNA_bind 412 572 2.8e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099067
Predicted Effect probably damaging
Transcript: ENSMUST00000109184
AA Change: T189A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: T189A

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 1.3e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137451
AA Change: T169A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118329
Gene: ENSMUSG00000027544
AA Change: T169A

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 216 235 N/A INTRINSIC
low complexity region 247 263 N/A INTRINSIC
Pfam:RHD 392 552 7.9e-25 PFAM
Blast:IPT 559 598 8e-19 BLAST
SCOP:d1imhc1 559 599 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140137
Predicted Effect probably benign
Transcript: ENSMUST00000171689
SMART Domains Protein: ENSMUSP00000130875
Gene: ENSMUSG00000027544

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
Pfam:RHD 191 351 1.3e-24 PFAM
Blast:IPT 358 397 4e-19 BLAST
SCOP:d1imhc1 358 398 1e-9 SMART
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Nfatc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Nfatc2 APN 2 168504890 missense probably damaging 1.00
IGL01728:Nfatc2 APN 2 168536242 missense probably damaging 1.00
IGL02303:Nfatc2 APN 2 168506901 nonsense probably null
IGL02887:Nfatc2 APN 2 168504450 missense probably damaging 1.00
IGL03002:Nfatc2 APN 2 168534984 missense probably damaging 1.00
IGL03297:Nfatc2 APN 2 168536218 missense probably damaging 0.99
R0347:Nfatc2 UTSW 2 168536290 missense probably damaging 1.00
R0631:Nfatc2 UTSW 2 168590115 missense probably benign 0.02
R1019:Nfatc2 UTSW 2 168504879 missense probably damaging 1.00
R1183:Nfatc2 UTSW 2 168590088 missense possibly damaging 0.83
R1420:Nfatc2 UTSW 2 168504665 missense probably benign 0.01
R1977:Nfatc2 UTSW 2 168504459 missense possibly damaging 0.68
R2306:Nfatc2 UTSW 2 168590103 missense probably damaging 1.00
R3034:Nfatc2 UTSW 2 168535020 missense probably damaging 1.00
R3176:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3276:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3964:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R3966:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R4669:Nfatc2 UTSW 2 168571490 missense probably benign
R4864:Nfatc2 UTSW 2 168536392 missense probably damaging 0.96
R4951:Nfatc2 UTSW 2 168571072 missense probably damaging 0.98
R5138:Nfatc2 UTSW 2 168536309 missense probably damaging 1.00
R5145:Nfatc2 UTSW 2 168590067 missense probably benign 0.25
R5185:Nfatc2 UTSW 2 168570707 missense possibly damaging 0.48
R5444:Nfatc2 UTSW 2 168534890 intron probably benign
R5496:Nfatc2 UTSW 2 168536278 missense probably damaging 1.00
R5728:Nfatc2 UTSW 2 168480249 missense probably benign
R5791:Nfatc2 UTSW 2 168536393 missense probably benign 0.28
R6102:Nfatc2 UTSW 2 168519507 intron probably benign
R6157:Nfatc2 UTSW 2 168519451 intron probably benign
R6187:Nfatc2 UTSW 2 168480238 missense probably benign 0.13
R7116:Nfatc2 UTSW 2 168507349 missense probably benign 0.04
R7218:Nfatc2 UTSW 2 168571264 missense probably benign 0.01
R7470:Nfatc2 UTSW 2 168523307 nonsense probably null
R7594:Nfatc2 UTSW 2 168523348 missense probably damaging 1.00
R7618:Nfatc2 UTSW 2 168534999 missense probably damaging 1.00
R7653:Nfatc2 UTSW 2 168571145 missense probably benign 0.01
Z1176:Nfatc2 UTSW 2 168571349 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAGGGCATCCATGAGAACAGC -3'
(R):5'- AACTTTCTGAGCCCGGTCAAGC -3'

Sequencing Primer
(F):5'- ACGAATGCCTCCGCTTG -3'
(R):5'- TCGGATCGAGATCACTCCATC -3'
Posted On2013-07-11