Incidental Mutation 'R7183:Fn3krp'
ID559122
Institutional Source Beutler Lab
Gene Symbol Fn3krp
Ensembl Gene ENSMUSG00000039253
Gene Namefructosamine 3 kinase related protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7183 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location121421401-121431288 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121421605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038096]
Predicted Effect probably null
Transcript: ENSMUST00000038096
SMART Domains Protein: ENSMUSP00000038061
Gene: ENSMUSG00000039253

DomainStartEndE-ValueType
Pfam:Fructosamin_kin 1 309 6e-81 PFAM
Pfam:APH 22 267 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Fn3krp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fn3krp APN 11 121421554 missense probably damaging 1.00
IGL01633:Fn3krp APN 11 121429707 nonsense probably null
IGL02123:Fn3krp APN 11 121429444 missense probably benign 0.00
IGL03189:Fn3krp APN 11 121429630 missense probably damaging 1.00
R0278:Fn3krp UTSW 11 121421580 missense probably damaging 1.00
R1927:Fn3krp UTSW 11 121424977 missense probably damaging 0.99
R3744:Fn3krp UTSW 11 121426705 critical splice donor site probably null
R4471:Fn3krp UTSW 11 121426673 missense probably benign 0.01
R4850:Fn3krp UTSW 11 121425053 missense possibly damaging 0.56
R5027:Fn3krp UTSW 11 121429448 missense probably benign 0.01
R5162:Fn3krp UTSW 11 121429584 missense probably damaging 1.00
R5444:Fn3krp UTSW 11 121421604 critical splice donor site probably null
R6230:Fn3krp UTSW 11 121425592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACTGGTCTGTGTCTACC -3'
(R):5'- ATAGCCACCGTTGCCTTAGC -3'

Sequencing Primer
(F):5'- TCTGCTCCAGGCCTGAACTG -3'
(R):5'- CCGGAGGCCAAAGGGAAATC -3'
Posted On2019-06-26