Incidental Mutation 'R7183:Cdkl1'
ID559124
Institutional Source Beutler Lab
Gene Symbol Cdkl1
Ensembl Gene ENSMUSG00000020990
Gene Namecyclin-dependent kinase-like 1 (CDC2-related kinase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7183 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69746848-69791267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69748932 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 275 (R275G)
Ref Sequence ENSEMBL: ENSMUSP00000021377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021372] [ENSMUST00000021377] [ENSMUST00000220916]
Predicted Effect probably benign
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000021377
AA Change: R275G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990
AA Change: R275G

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220916
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Cdkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Cdkl1 APN 12 69750740 missense probably benign
IGL01859:Cdkl1 APN 12 69760129 missense probably damaging 1.00
R0218:Cdkl1 UTSW 12 69790035 missense probably benign 0.01
R0905:Cdkl1 UTSW 12 69756564 nonsense probably null
R3922:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3924:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3925:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R5050:Cdkl1 UTSW 12 69757240 missense probably damaging 1.00
R5851:Cdkl1 UTSW 12 69756564 nonsense probably null
R7271:Cdkl1 UTSW 12 69748811 missense probably benign 0.10
R7461:Cdkl1 UTSW 12 69756461 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CAGTACCAGGTAACAGATATGAGATC -3'
(R):5'- CCGCACAAAGGATGCTAATGC -3'

Sequencing Primer
(F):5'- GAGATCATTAGAAACTGTAAGCTTGG -3'
(R):5'- GCAGTCAGAAGCACTTGTTC -3'
Posted On2019-06-26