Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Actn1'

559125

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.588) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80168932 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 816 (M816L)

Ref Sequence

ENSEMBL: ENSMUSP00000021554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

AlphaFold

Q7TPR4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021554
AA Change: M816L

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: M816L

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167327
AA Change: M811L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: M811L

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1519:Actn1	UTSW	12	80205078	missense	probably damaging	1.00
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4024:Actn1	UTSW	12	80168477	missense	probably damaging	1.00
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R4972:Actn1	UTSW	12	80173039	missense	probably benign	0.35
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R6709:Actn1	UTSW	12	80193644	missense	probably damaging	1.00
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7116:Actn1	UTSW	12	80204977	missense	probably damaging	1.00
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7291:Actn1	UTSW	12	80174085	missense	probably benign	0.00
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null
R8469:Actn1	UTSW	12	80193683	missense	possibly damaging	0.95
R8794:Actn1	UTSW	12	80198980	critical splice donor site	probably benign
R8887:Actn1	UTSW	12	80168423	missense	probably damaging	1.00
R9237:Actn1	UTSW	12	80193696	missense	possibly damaging	0.92
R9269:Actn1	UTSW	12	80172971	missense	probably benign	0.01
R9520:Actn1	UTSW	12	80193643	missense	probably damaging	1.00
R9526:Actn1	UTSW	12	80183619	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTGCGTGCATACATATAACAGAG -3'
(R):5'- TCCTGTTCCAACCATAGGCAAC -3'

Sequencing Primer
(F):5'- CAGAGACATCCGTGTGTATGTAC -3'
(R):5'- CTTGGAGCTGGAGGTACAC -3'

Posted On

2019-06-26