Incidental Mutation 'R7183:Rbp3'

• ID: 559129
• Institutional Source: Beutler Lab
• Gene Symbol: Rbp3
• Ensembl Gene: ENSMUSG00000041534
• Gene Name: retinol binding protein 3, interstitial
• Synonyms: Rbp-3, Irbp
• MMRRC Submission: 045235-MU
• Essential gene?: Probably non essential (E-score: 0.092)
• Stock #: R7183 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 14
• Chromosomal Location: 33954003-33964216 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 33955204 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Threonine to Alanine at position 370 (T370A)
• Ref Sequence: ENSEMBL: ENSMUSP00000040249
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000035695]
• AlphaFold: no structure available at present
• Predicted Effect: probably benign; Transcript: ENSMUST00000035695; AA Change: T370A; PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
• SMART Domains: Protein: ENSMUSP00000040249; Gene: ENSMUSG00000041534; AA Change: T370A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

• Meta Mutation Damage Score: 0.0600
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
• Validation Efficiency: 100% (65/65)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
• Posted On: 2019-06-26

Predicted Primers

PCR Primer
(F):5'- AAGCCCTAGAAAAGGCCCTG -3'
(R):5'- AATCTATCAAAGCGCAGGTAGC -3'

Sequencing Primer
(F):5'- TGGCCATCCTCACCCTG -3'
(R):5'- AGGTAGCCCACATTGCCC -3'