Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Thbs2'

559135

Institutional Source

Beutler Lab

Gene Symbol

Thbs2

Ensembl Gene

ENSMUSG00000023885

Gene Name

thrombospondin 2

Synonyms

Thbs-2, Thrombospondin-2, TSP2

MMRRC Submission

045235-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14665500-14694235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14690116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 74 (I74F)

Ref Sequence

ENSEMBL: ENSMUSP00000128308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170872]

AlphaFold

Q03350

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170872
AA Change: I74F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: I74F

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
TSPN	21	215	3.8e-60	SMART
VWC	320	374	3.55e-19	SMART
TSP1	384	431	3.36e-11	SMART
TSP1	440	492	1.35e-15	SMART
TSP1	497	549	8.6e-18	SMART
EGF	552	589	6.3e-3	SMART
EGF	593	647	1.56e1	SMART
EGF	651	692	2.19e-2	SMART
Pfam:TSP_3	729	764	2.5e-12	PFAM
Pfam:TSP_3	763	787	7.4e-7	PFAM
Pfam:TSP_3	788	823	9.4e-12	PFAM
Pfam:TSP_3	823	846	4.1e-7	PFAM
Pfam:TSP_3	847	884	1.7e-12	PFAM
Pfam:TSP_3	885	920	1.3e-11	PFAM
Pfam:TSP_3	921	956	3.1e-11	PFAM
Pfam:TSP_C	974	1171	1e-98	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Thbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Thbs2	APN	17	14668835	missense	probably damaging	1.00
IGL00764:Thbs2	APN	17	14690252	missense	probably damaging	0.98
IGL01370:Thbs2	APN	17	14690065	missense	possibly damaging	0.82
IGL01604:Thbs2	APN	17	14678769	missense	probably benign	0.31
IGL01936:Thbs2	APN	17	14687814	missense	probably benign	0.00
IGL02061:Thbs2	APN	17	14679914	missense	probably benign	0.35
IGL02255:Thbs2	APN	17	14689785	missense	probably benign	0.00
IGL02342:Thbs2	APN	17	14676316	missense	probably damaging	1.00
IGL02402:Thbs2	APN	17	14671454	missense	probably benign	0.01
IGL02499:Thbs2	APN	17	14684066	splice site	probably benign
IGL02572:Thbs2	APN	17	14677013	missense	possibly damaging	0.72
IGL02701:Thbs2	APN	17	14683361	missense	probably benign	0.05
IGL02871:Thbs2	APN	17	14685786	missense	probably benign
IGL03058:Thbs2	APN	17	14689969	missense	possibly damaging	0.91
IGL03185:Thbs2	APN	17	14681410	nonsense	probably null
IGL03232:Thbs2	APN	17	14691413	start codon destroyed	probably null
IGL03289:Thbs2	APN	17	14690122	missense	probably benign	0.00
IGL03407:Thbs2	APN	17	14673273	missense	probably benign	0.00
H8562:Thbs2	UTSW	17	14671453	missense	probably benign	0.00
IGL02802:Thbs2	UTSW	17	14684127	missense	probably benign	0.01
PIT4354001:Thbs2	UTSW	17	14689968	missense	probably damaging	0.99
R0088:Thbs2	UTSW	17	14681701	missense	possibly damaging	0.96
R0167:Thbs2	UTSW	17	14667525	splice site	probably benign
R0415:Thbs2	UTSW	17	14679973	missense	probably benign
R0658:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R0735:Thbs2	UTSW	17	14679815	missense	probably benign	0.00
R1582:Thbs2	UTSW	17	14671288	missense	probably damaging	1.00
R1585:Thbs2	UTSW	17	14689768	missense	probably benign	0.00
R1608:Thbs2	UTSW	17	14685781	missense	probably benign
R1721:Thbs2	UTSW	17	14678810	missense	probably benign	0.00
R1724:Thbs2	UTSW	17	14685900	missense	possibly damaging	0.80
R1791:Thbs2	UTSW	17	14685813	missense	probably benign
R1816:Thbs2	UTSW	17	14670713	missense	probably benign	0.01
R1816:Thbs2	UTSW	17	14670714	missense	probably benign	0.00
R1911:Thbs2	UTSW	17	14689842	missense	probably benign	0.38
R2137:Thbs2	UTSW	17	14673306	missense	probably damaging	1.00
R2152:Thbs2	UTSW	17	14673209	missense	probably damaging	1.00
R2244:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R2325:Thbs2	UTSW	17	14690289	splice site	probably null
R2509:Thbs2	UTSW	17	14685843	missense	probably benign	0.11
R3838:Thbs2	UTSW	17	14687851	missense	probably benign
R4173:Thbs2	UTSW	17	14681631	splice site	probably null
R4427:Thbs2	UTSW	17	14680335	missense	probably benign
R4495:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R4789:Thbs2	UTSW	17	14671488	missense	probably damaging	1.00
R4928:Thbs2	UTSW	17	14678900	missense	probably damaging	1.00
R5058:Thbs2	UTSW	17	14676329	missense	probably damaging	1.00
R5112:Thbs2	UTSW	17	14670590	splice site	probably null
R5619:Thbs2	UTSW	17	14681244	missense	probably damaging	1.00
R5649:Thbs2	UTSW	17	14689953	missense	probably damaging	1.00
R5664:Thbs2	UTSW	17	14689837	missense	probably damaging	1.00
R5801:Thbs2	UTSW	17	14687863	missense	probably damaging	1.00
R5816:Thbs2	UTSW	17	14684071	critical splice donor site	probably null
R5840:Thbs2	UTSW	17	14681430	splice site	probably null
R6149:Thbs2	UTSW	17	14679680	critical splice donor site	probably null
R6166:Thbs2	UTSW	17	14680388	missense	probably damaging	1.00
R6412:Thbs2	UTSW	17	14677077	missense	probably damaging	1.00
R6473:Thbs2	UTSW	17	14685796	missense	probably benign	0.23
R6640:Thbs2	UTSW	17	14673368	missense	possibly damaging	0.94
R6695:Thbs2	UTSW	17	14674164	missense	possibly damaging	0.54
R6711:Thbs2	UTSW	17	14690265	missense	probably benign	0.00
R6947:Thbs2	UTSW	17	14689767	missense	possibly damaging	0.79
R6962:Thbs2	UTSW	17	14681820	missense	probably benign	0.00
R7203:Thbs2	UTSW	17	14671458	missense	probably damaging	1.00
R7386:Thbs2	UTSW	17	14673150	missense	possibly damaging	0.95
R7621:Thbs2	UTSW	17	14674164	missense	probably benign
R7747:Thbs2	UTSW	17	14670039	missense	possibly damaging	0.94
R7759:Thbs2	UTSW	17	14677059	missense	probably damaging	1.00
R7800:Thbs2	UTSW	17	14676296	missense	probably damaging	1.00
R7895:Thbs2	UTSW	17	14676221	missense	probably damaging	1.00
R8094:Thbs2	UTSW	17	14680322	missense	probably benign	0.00
R8332:Thbs2	UTSW	17	14679770	missense	probably damaging	1.00
R8478:Thbs2	UTSW	17	14680404	missense	probably benign	0.00
R8695:Thbs2	UTSW	17	14679701	missense	probably benign
R8707:Thbs2	UTSW	17	14691383	missense	probably damaging	1.00
R9001:Thbs2	UTSW	17	14668745	missense	probably damaging	1.00
R9075:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R9183:Thbs2	UTSW	17	14676264	missense	probably benign	0.03
R9461:Thbs2	UTSW	17	14690173	missense	probably damaging	1.00
R9462:Thbs2	UTSW	17	14669981	missense	probably damaging	1.00
R9536:Thbs2	UTSW	17	14689885	missense	probably damaging	1.00
R9592:Thbs2	UTSW	17	14678821	missense	probably damaging	1.00
S24628:Thbs2	UTSW	17	14679973	missense	probably benign
X0025:Thbs2	UTSW	17	14681800	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ATGCTGATTGCCTTCTACCCAG -3'
(R):5'- TCAGCATCAGCCTGTGATAAC -3'

Sequencing Primer
(F):5'- TCTACCCAGTAGTTGAGGTCCAAAG -3'
(R):5'- AGCCTGTGATAACTGTGACC -3'

Posted On

2019-06-26