Incidental Mutation 'R7183:Vmn2r101'
ID 559136
Institutional Source Beutler Lab
Gene Symbol Vmn2r101
Ensembl Gene ENSMUSG00000094892
Gene Name vomeronasal 2, receptor 101
Synonyms EG627576
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19577231-19612317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19612178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 812 (I812N)
Ref Sequence ENSEMBL: ENSMUSP00000131583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171914]
AlphaFold E9PZS9
Predicted Effect probably damaging
Transcript: ENSMUST00000171914
AA Change: I812N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131583
Gene: ENSMUSG00000094892
AA Change: I812N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 466 1.6e-36 PFAM
Pfam:NCD3G 509 562 6.4e-22 PFAM
Pfam:7tm_3 595 830 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Vmn2r101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Vmn2r101 APN 17 19589674 missense probably damaging 0.99
IGL02125:Vmn2r101 APN 17 19589701 missense possibly damaging 0.95
IGL02300:Vmn2r101 APN 17 19611937 missense probably damaging 1.00
IGL02682:Vmn2r101 APN 17 19612245 missense possibly damaging 0.82
IGL02825:Vmn2r101 APN 17 19589870 missense probably benign 0.00
IGL02862:Vmn2r101 APN 17 19611605 missense probably damaging 1.00
IGL02943:Vmn2r101 APN 17 19611404 missense probably damaging 0.99
R0371:Vmn2r101 UTSW 17 19590132 missense probably benign 0.07
R0462:Vmn2r101 UTSW 17 19590169 missense probably benign 0.04
R0492:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
R0654:Vmn2r101 UTSW 17 19590111 missense probably benign 0.01
R1120:Vmn2r101 UTSW 17 19577461 splice site probably benign
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1676:Vmn2r101 UTSW 17 19611922 missense probably benign 0.00
R2023:Vmn2r101 UTSW 17 19590106 nonsense probably null
R2149:Vmn2r101 UTSW 17 19588963 missense probably benign 0.00
R2350:Vmn2r101 UTSW 17 19589783 missense probably benign 0.01
R2760:Vmn2r101 UTSW 17 19589639 missense probably benign 0.14
R3085:Vmn2r101 UTSW 17 19588815 splice site probably null
R3086:Vmn2r101 UTSW 17 19588815 splice site probably null
R3719:Vmn2r101 UTSW 17 19589549 missense possibly damaging 0.50
R3771:Vmn2r101 UTSW 17 19589657 missense probably benign
R3773:Vmn2r101 UTSW 17 19589657 missense probably benign
R4225:Vmn2r101 UTSW 17 19611689 missense probably damaging 1.00
R4248:Vmn2r101 UTSW 17 19589114 missense probably damaging 1.00
R4290:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4291:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4293:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4307:Vmn2r101 UTSW 17 19590161 missense probably damaging 1.00
R4721:Vmn2r101 UTSW 17 19612025 missense probably damaging 0.99
R4829:Vmn2r101 UTSW 17 19611967 missense probably benign 0.03
R5022:Vmn2r101 UTSW 17 19611387 critical splice acceptor site probably null
R5110:Vmn2r101 UTSW 17 19611635 missense possibly damaging 0.92
R5244:Vmn2r101 UTSW 17 19611526 missense probably damaging 1.00
R5397:Vmn2r101 UTSW 17 19588842 missense probably damaging 1.00
R5875:Vmn2r101 UTSW 17 19588830 missense probably damaging 0.99
R5944:Vmn2r101 UTSW 17 19589507 missense probably benign 0.00
R6216:Vmn2r101 UTSW 17 19591005 missense probably benign 0.00
R6334:Vmn2r101 UTSW 17 19589850 missense possibly damaging 0.83
R6512:Vmn2r101 UTSW 17 19588884 missense probably damaging 1.00
R6607:Vmn2r101 UTSW 17 19612034 missense probably damaging 1.00
R6965:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R7101:Vmn2r101 UTSW 17 19589088 missense probably null 0.14
R7344:Vmn2r101 UTSW 17 19611797 missense probably benign 0.38
R7375:Vmn2r101 UTSW 17 19611390 missense probably damaging 1.00
R7574:Vmn2r101 UTSW 17 19611637 missense possibly damaging 0.91
R7575:Vmn2r101 UTSW 17 19611392 missense probably benign 0.01
R7592:Vmn2r101 UTSW 17 19591181 splice site probably null
R7626:Vmn2r101 UTSW 17 19611930 nonsense probably null
R7715:Vmn2r101 UTSW 17 19611915 missense probably damaging 1.00
R7730:Vmn2r101 UTSW 17 19611688 missense possibly damaging 0.81
R8078:Vmn2r101 UTSW 17 19590245 missense probably benign 0.07
R8228:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R8283:Vmn2r101 UTSW 17 19611991 missense probably damaging 1.00
R8712:Vmn2r101 UTSW 17 19591135 missense probably benign 0.24
R8765:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
R9091:Vmn2r101 UTSW 17 19589982 missense probably benign
R9092:Vmn2r101 UTSW 17 19589545 missense probably benign 0.07
R9113:Vmn2r101 UTSW 17 19591026 missense possibly damaging 0.56
R9158:Vmn2r101 UTSW 17 19588899 missense probably benign 0.00
R9168:Vmn2r101 UTSW 17 19588876 missense probably damaging 1.00
R9235:Vmn2r101 UTSW 17 19589976 missense probably damaging 0.99
R9270:Vmn2r101 UTSW 17 19589982 missense probably benign
R9290:Vmn2r101 UTSW 17 19591133 missense probably benign 0.05
R9296:Vmn2r101 UTSW 17 19589785 missense probably damaging 0.98
R9602:Vmn2r101 UTSW 17 19611518 nonsense probably null
R9706:Vmn2r101 UTSW 17 19589663 missense probably damaging 1.00
Z1088:Vmn2r101 UTSW 17 19588975 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTTGGGAGTTATACCATGGCC -3'
(R):5'- AGGTGGTTGTCAAACATGGG -3'

Sequencing Primer
(F):5'- GGAGTTATACCATGGCCTTCTTGTC -3'
(R):5'- TGGTTGTCAAACATGGGAAATAAATG -3'
Posted On 2019-06-26