Incidental Mutation 'R7183:Ehd1'
ID559139
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene NameEH-domain containing 1
SynonymsRME-1, Past1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7183 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6276725-6300096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6297654 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 346 (H346R)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
Predicted Effect probably benign
Transcript: ENSMUST00000025684
AA Change: H346R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: H346R

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6298147 missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6294300 missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6277338 missense probably damaging 1.00
declining UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6298300 missense probably benign 0.04
R2062:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2064:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2065:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2066:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2067:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2068:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2217:Ehd1 UTSW 19 6298472 missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6277014 nonsense probably null
R3705:Ehd1 UTSW 19 6298300 missense probably benign 0.04
R4654:Ehd1 UTSW 19 6276964 utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6294243 missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6297694 missense probably benign 0.14
R5076:Ehd1 UTSW 19 6277221 missense probably benign 0.02
R6327:Ehd1 UTSW 19 6298345 missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6294444 missense probably benign 0.01
R7120:Ehd1 UTSW 19 6297561 missense probably benign 0.00
R7215:Ehd1 UTSW 19 6297642 missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6277195 missense probably damaging 0.99
R7936:Ehd1 UTSW 19 6277195 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTTAGAGGCACCCTTTCC -3'
(R):5'- TCTCGACCTAGGTCAACTCTG -3'

Sequencing Primer
(F):5'- ACTGAGCTTGAGGCACTGG -3'
(R):5'- TCAACTCTGACTCAGATAGGGAACTG -3'
Posted On2019-06-26