Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Ehd1'

559139

Institutional Source

Beutler Lab

Gene Symbol

Ehd1

Ensembl Gene

ENSMUSG00000024772

Gene Name

EH-domain containing 1

Synonyms

RME-1, Past1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6276725-6300096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6297654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 346 (H346R)

Ref Sequence

ENSEMBL: ENSMUSP00000025684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025684]

AlphaFold

Q9WVK4

Predicted Effect

probably benign
Transcript: ENSMUST00000025684
AA Change: H346R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: H346R

Domain	Start	End	E-Value	Type
Pfam:EHD_N	24	56	1.2e-19	PFAM
Pfam:MMR_HSR1	60	220	5.1e-9	PFAM
Pfam:Dynamin_N	61	221	6.6e-15	PFAM
low complexity region	420	433	N/A	INTRINSIC
EH	438	531	1.82e-45	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Ehd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01109:Ehd1	APN	19	6298147	missense	possibly damaging	0.86
IGL02573:Ehd1	APN	19	6294300	missense	probably damaging	1.00
IGL03146:Ehd1	APN	19	6277338	missense	probably damaging	1.00
declining	UTSW	19	6294388	missense	probably damaging	1.00
R1376:Ehd1	UTSW	19	6294388	missense	probably damaging	1.00
R1376:Ehd1	UTSW	19	6294388	missense	probably damaging	1.00
R1593:Ehd1	UTSW	19	6298300	missense
R2062:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2064:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2065:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2066:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2067:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2068:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2217:Ehd1	UTSW	19	6298472	missense	probably damaging	1.00
R3436:Ehd1	UTSW	19	6277014	nonsense	probably null
R3705:Ehd1	UTSW	19	6298300	missense
R4654:Ehd1	UTSW	19	6276964	utr 5 prime	probably benign
R4902:Ehd1	UTSW	19	6294243	missense	possibly damaging	0.91
R5001:Ehd1	UTSW	19	6297694	missense	probably benign	0.14
R5076:Ehd1	UTSW	19	6277221	missense	probably benign	0.02
R6327:Ehd1	UTSW	19	6298345	missense	possibly damaging	0.81
R6679:Ehd1	UTSW	19	6294444	missense	probably benign	0.01
R7120:Ehd1	UTSW	19	6297561	missense	probably benign	0.00
R7215:Ehd1	UTSW	19	6297642	missense	possibly damaging	0.81
R7853:Ehd1	UTSW	19	6277195	missense	probably damaging	0.99
R8467:Ehd1	UTSW	19	6281288	missense	probably benign	0.24
R8523:Ehd1	UTSW	19	6294583	missense	probably damaging	0.98
R8879:Ehd1	UTSW	19	6298324	missense	probably damaging	0.97
R8957:Ehd1	UTSW	19	6294409	missense	probably damaging	1.00
R9011:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R9664:Ehd1	UTSW	19	6281232	missense	probably benign	0.01
R9687:Ehd1	UTSW	19	6298300	missense

Predicted Primers

PCR Primer
(F):5'- GTGTTAGAGGCACCCTTTCC -3'
(R):5'- TCTCGACCTAGGTCAACTCTG -3'

Sequencing Primer
(F):5'- ACTGAGCTTGAGGCACTGG -3'
(R):5'- TCAACTCTGACTCAGATAGGGAACTG -3'

Posted On

2019-06-26