Incidental Mutation 'R0590:Fam160a1'
ID55914
Institutional Source Beutler Lab
Gene Symbol Fam160a1
Ensembl Gene ENSMUSG00000051000
Gene Namefamily with sequence similarity 160, member A1
Synonyms9930021J17Rik
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location85660061-85817291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85672376 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 841 (R841G)
Ref Sequence ENSEMBL: ENSMUSP00000113235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
Predicted Effect probably benign
Transcript: ENSMUST00000094148
AA Change: R841G

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: R841G

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118408
AA Change: R841G

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: R841G

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

DomainStartEndE-ValueType
low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126445
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Fam160a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam160a1 APN 3 85672618 missense probably benign 0.01
IGL01102:Fam160a1 APN 3 85665501 intron probably benign
IGL01317:Fam160a1 APN 3 85672846 missense probably benign 0.01
IGL01759:Fam160a1 APN 3 85688447 missense probably damaging 1.00
IGL02007:Fam160a1 APN 3 85722445 missense probably damaging 1.00
IGL02037:Fam160a1 APN 3 85730632 missense probably damaging 0.99
IGL02163:Fam160a1 APN 3 85688552 missense possibly damaging 0.92
IGL02192:Fam160a1 APN 3 85673326 missense possibly damaging 0.82
IGL02617:Fam160a1 APN 3 85673037 missense probably benign 0.00
PIT4378001:Fam160a1 UTSW 3 85730551 missense probably damaging 1.00
PIT4520001:Fam160a1 UTSW 3 85672472 nonsense probably null
PIT4651001:Fam160a1 UTSW 3 85683641 missense probably damaging 1.00
R0625:Fam160a1 UTSW 3 85730500 missense possibly damaging 0.84
R0648:Fam160a1 UTSW 3 85730614 missense probably damaging 1.00
R0931:Fam160a1 UTSW 3 85673243 missense probably benign
R0940:Fam160a1 UTSW 3 85665490 missense possibly damaging 0.92
R0941:Fam160a1 UTSW 3 85673059 missense probably benign 0.03
R1115:Fam160a1 UTSW 3 85722495 missense probably benign 0.02
R1161:Fam160a1 UTSW 3 85672468 missense probably damaging 0.96
R1460:Fam160a1 UTSW 3 85730876 missense probably damaging 1.00
R1503:Fam160a1 UTSW 3 85672477 missense possibly damaging 0.70
R1545:Fam160a1 UTSW 3 85665954 missense probably damaging 1.00
R1820:Fam160a1 UTSW 3 85665829 missense probably damaging 1.00
R1907:Fam160a1 UTSW 3 85672633 missense probably benign 0.00
R1911:Fam160a1 UTSW 3 85661218 missense probably benign 0.12
R1928:Fam160a1 UTSW 3 85688531 missense probably damaging 1.00
R2200:Fam160a1 UTSW 3 85730321 missense probably damaging 1.00
R2235:Fam160a1 UTSW 3 85661101 missense probably damaging 0.97
R2373:Fam160a1 UTSW 3 85676097 nonsense probably null
R3084:Fam160a1 UTSW 3 85665968 critical splice acceptor site probably null
R4125:Fam160a1 UTSW 3 85665383 missense possibly damaging 0.87
R4601:Fam160a1 UTSW 3 85741180 missense probably damaging 1.00
R4612:Fam160a1 UTSW 3 85730372 nonsense probably null
R4665:Fam160a1 UTSW 3 85730681 missense probably damaging 1.00
R4673:Fam160a1 UTSW 3 85730713 missense probably damaging 1.00
R4707:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4783:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4785:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4825:Fam160a1 UTSW 3 85673432 missense possibly damaging 0.93
R4884:Fam160a1 UTSW 3 85683611 missense probably damaging 1.00
R5653:Fam160a1 UTSW 3 85722501 missense probably damaging 1.00
R5663:Fam160a1 UTSW 3 85672433 missense probably benign
R5764:Fam160a1 UTSW 3 85665865 missense probably damaging 1.00
R6134:Fam160a1 UTSW 3 85673344 missense possibly damaging 0.93
R6284:Fam160a1 UTSW 3 85672688 missense probably benign 0.01
R6789:Fam160a1 UTSW 3 85672558 nonsense probably null
R6843:Fam160a1 UTSW 3 85673045 missense probably damaging 0.96
R7305:Fam160a1 UTSW 3 85730524 missense probably damaging 1.00
R7406:Fam160a1 UTSW 3 85730477 missense probably benign 0.13
R7448:Fam160a1 UTSW 3 85672564 missense probably benign 0.00
R7469:Fam160a1 UTSW 3 85672762 missense probably benign 0.00
R7578:Fam160a1 UTSW 3 85665898 missense probably damaging 0.99
R7707:Fam160a1 UTSW 3 85676253 missense probably benign 0.21
Z1176:Fam160a1 UTSW 3 85673201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTCACCTGTGAACGGCGTACTC -3'
(R):5'- TCAGAACACGTTCTCAGAAGCCAAG -3'

Sequencing Primer
(F):5'- TACTCTGAGTCCTCACGGGATG -3'
(R):5'- AGCCTTAGCATTAGACTCGG -3'
Posted On2013-07-11