Incidental Mutation 'R7183:Cdc42bpg'
ID559140
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7183 (G1)
Quality Score189.009
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6310797 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 195 (D195G)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: D195G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: D195G

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R7986:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R8186:Cdc42bpg UTSW 19 6306865 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCATTGTGAGCATGTAC -3'
(R):5'- GCGACTGATGAATCCACCTGTG -3'

Sequencing Primer
(F):5'- TTGTGAGCATGTACACACACAG -3'
(R):5'- TGTTGGCACCATGAGGC -3'
Posted On2019-06-26