Incidental Mutation 'R7183:Or5b102'
ID 559142
Institutional Source Beutler Lab
Gene Symbol Or5b102
Ensembl Gene ENSMUSG00000094986
Gene Name olfactory receptor family 5 subfamily B member 102
Synonyms MOR202-14, GA_x6K02T2RE5P-3390804-3391727, Olfr1454
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13040777-13041700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13041680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 302 (I302V)
Ref Sequence ENSEMBL: ENSMUSP00000150001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073732] [ENSMUST00000213806] [ENSMUST00000214695] [ENSMUST00000217568]
AlphaFold Q8VFW2
Predicted Effect probably benign
Transcript: ENSMUST00000073732
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073409
Gene: ENSMUSG00000094986
AA Change: I302V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-50 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213806
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214695
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217568
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Or5b102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Or5b102 APN 19 13,041,513 (GRCm39) missense probably damaging 1.00
IGL02942:Or5b102 APN 19 13,041,552 (GRCm39) missense probably benign 0.45
IGL03331:Or5b102 APN 19 13,041,231 (GRCm39) missense probably damaging 1.00
R0551:Or5b102 UTSW 19 13,041,658 (GRCm39) missense probably benign 0.01
R0738:Or5b102 UTSW 19 13,041,102 (GRCm39) missense probably damaging 1.00
R1532:Or5b102 UTSW 19 13,041,639 (GRCm39) missense probably damaging 1.00
R2072:Or5b102 UTSW 19 13,041,044 (GRCm39) missense probably benign 0.00
R2092:Or5b102 UTSW 19 13,041,166 (GRCm39) nonsense probably null
R2656:Or5b102 UTSW 19 13,041,348 (GRCm39) missense probably benign 0.05
R2850:Or5b102 UTSW 19 13,040,934 (GRCm39) missense probably damaging 1.00
R4212:Or5b102 UTSW 19 13,041,123 (GRCm39) missense probably damaging 0.98
R5303:Or5b102 UTSW 19 13,041,139 (GRCm39) nonsense probably null
R6362:Or5b102 UTSW 19 13,040,709 (GRCm39) start gained probably benign
R6928:Or5b102 UTSW 19 13,041,348 (GRCm39) missense probably benign 0.05
R7701:Or5b102 UTSW 19 13,041,445 (GRCm39) missense probably damaging 1.00
R7741:Or5b102 UTSW 19 13,041,423 (GRCm39) missense probably damaging 0.98
R8057:Or5b102 UTSW 19 13,040,638 (GRCm39) start gained probably benign
R8272:Or5b102 UTSW 19 13,040,795 (GRCm39) missense possibly damaging 0.47
R8534:Or5b102 UTSW 19 13,041,432 (GRCm39) missense probably damaging 1.00
R8769:Or5b102 UTSW 19 13,041,307 (GRCm39) nonsense probably null
R9400:Or5b102 UTSW 19 13,041,139 (GRCm39) nonsense probably null
R9511:Or5b102 UTSW 19 13,041,119 (GRCm39) missense probably damaging 0.99
R9651:Or5b102 UTSW 19 13,041,256 (GRCm39) missense probably benign 0.01
Z1176:Or5b102 UTSW 19 13,041,010 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CAGCTGTCTCTATTTTCTATGGGAC -3'
(R):5'- AGGACCTTTCTAAGCACCTGC -3'

Sequencing Primer
(F):5'- GGGACTATCATATTCATGTACTTGC -3'
(R):5'- CTTTCTAAGCACCTGCATACATAG -3'
Posted On 2019-06-26