Incidental Mutation 'R7183:Olfr1454'
ID 559142
Institutional Source Beutler Lab
Gene Symbol Olfr1454
Ensembl Gene ENSMUSG00000094986
Gene Name olfactory receptor 1454
Synonyms MOR202-14, GA_x6K02T2RE5P-3390804-3391727
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13060610-13067157 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13064316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 302 (I302V)
Ref Sequence ENSEMBL: ENSMUSP00000150001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073732] [ENSMUST00000213806] [ENSMUST00000214695] [ENSMUST00000217568]
AlphaFold Q8VFW2
Predicted Effect probably benign
Transcript: ENSMUST00000073732
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073409
Gene: ENSMUSG00000094986
AA Change: I302V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-50 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213806
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214695
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217568
AA Change: I302V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Pfkl G A 10: 78,002,082 R31* probably null Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Olfr1454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Olfr1454 APN 19 13064149 missense probably damaging 1.00
IGL02942:Olfr1454 APN 19 13064188 missense probably benign 0.45
IGL03331:Olfr1454 APN 19 13063867 missense probably damaging 1.00
R0551:Olfr1454 UTSW 19 13064294 missense probably benign 0.01
R0738:Olfr1454 UTSW 19 13063738 missense probably damaging 1.00
R1532:Olfr1454 UTSW 19 13064275 missense probably damaging 1.00
R2072:Olfr1454 UTSW 19 13063680 missense probably benign 0.00
R2092:Olfr1454 UTSW 19 13063802 nonsense probably null
R2656:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R2850:Olfr1454 UTSW 19 13063570 missense probably damaging 1.00
R4212:Olfr1454 UTSW 19 13063759 missense probably damaging 0.98
R5303:Olfr1454 UTSW 19 13063775 nonsense probably null
R6362:Olfr1454 UTSW 19 13063345 start gained probably benign
R6928:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R7701:Olfr1454 UTSW 19 13064081 missense probably damaging 1.00
R7741:Olfr1454 UTSW 19 13064059 missense probably damaging 0.98
R8057:Olfr1454 UTSW 19 13063274 start gained probably benign
R8272:Olfr1454 UTSW 19 13063431 missense possibly damaging 0.47
R8534:Olfr1454 UTSW 19 13064068 missense probably damaging 1.00
R8769:Olfr1454 UTSW 19 13063943 nonsense probably null
R9400:Olfr1454 UTSW 19 13063775 nonsense probably null
R9511:Olfr1454 UTSW 19 13063755 missense probably damaging 0.99
R9651:Olfr1454 UTSW 19 13063892 missense probably benign 0.01
Z1176:Olfr1454 UTSW 19 13063646 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CAGCTGTCTCTATTTTCTATGGGAC -3'
(R):5'- AGGACCTTTCTAAGCACCTGC -3'

Sequencing Primer
(F):5'- GGGACTATCATATTCATGTACTTGC -3'
(R):5'- CTTTCTAAGCACCTGCATACATAG -3'
Posted On 2019-06-26