Incidental Mutation 'R7183:Pdzd7'
ID 559144
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene Name PDZ domain containing 7
Synonyms EG435601, Pdzk7
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 45015345-45034156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45025553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 314 (V314A)
Ref Sequence ENSEMBL: ENSMUSP00000119002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145391] [ENSMUST00000169459]
AlphaFold E9Q9W7
Predicted Effect probably benign
Transcript: ENSMUST00000145391
AA Change: V314A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: V314A

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169459
AA Change: V314A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: V314A

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45,028,697 (GRCm39) missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45,034,082 (GRCm39) start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45,025,173 (GRCm39) missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45,022,106 (GRCm39) missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45,022,106 (GRCm39) missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45,025,511 (GRCm39) missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45,024,529 (GRCm39) missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45,033,914 (GRCm39) missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45,017,744 (GRCm39) missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45,029,124 (GRCm39) missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45,033,950 (GRCm39) missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45,027,667 (GRCm39) missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45,024,615 (GRCm39) missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45,024,494 (GRCm39) critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45,016,113 (GRCm39) missense probably benign
R2852:Pdzd7 UTSW 19 45,016,113 (GRCm39) missense probably benign
R2939:Pdzd7 UTSW 19 45,033,862 (GRCm39) missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45,028,693 (GRCm39) missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45,034,067 (GRCm39) missense probably benign
R4416:Pdzd7 UTSW 19 45,029,019 (GRCm39) missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45,034,126 (GRCm39) start gained probably benign
R5133:Pdzd7 UTSW 19 45,016,868 (GRCm39) missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45,017,216 (GRCm39) missense probably benign
R5458:Pdzd7 UTSW 19 45,016,230 (GRCm39) missense probably benign
R5480:Pdzd7 UTSW 19 45,027,724 (GRCm39) missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45,028,619 (GRCm39) missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45,025,428 (GRCm39) missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45,025,310 (GRCm39) missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45,016,388 (GRCm39) missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45,025,190 (GRCm39) missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45,016,187 (GRCm39) missense probably benign
R7128:Pdzd7 UTSW 19 45,016,388 (GRCm39) missense probably damaging 0.99
R7378:Pdzd7 UTSW 19 45,034,045 (GRCm39) missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45,025,450 (GRCm39) missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45,022,086 (GRCm39) missense possibly damaging 0.68
R7790:Pdzd7 UTSW 19 45,033,962 (GRCm39) nonsense probably null
R7792:Pdzd7 UTSW 19 45,028,657 (GRCm39) missense possibly damaging 0.54
R7829:Pdzd7 UTSW 19 45,027,678 (GRCm39) missense probably benign 0.00
R7883:Pdzd7 UTSW 19 45,018,679 (GRCm39) missense probably damaging 1.00
R7969:Pdzd7 UTSW 19 45,024,664 (GRCm39) missense probably benign 0.01
R8387:Pdzd7 UTSW 19 45,018,490 (GRCm39) missense probably damaging 1.00
R8720:Pdzd7 UTSW 19 45,024,667 (GRCm39) missense probably benign 0.27
R8830:Pdzd7 UTSW 19 45,021,512 (GRCm39) missense probably damaging 1.00
R9282:Pdzd7 UTSW 19 45,028,622 (GRCm39) missense probably damaging 0.96
R9417:Pdzd7 UTSW 19 45,034,022 (GRCm39) missense probably damaging 1.00
R9453:Pdzd7 UTSW 19 45,016,056 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTTCCACTCGGCTGTC -3'
(R):5'- AGAGAAATGACTTCCCAGGGC -3'

Sequencing Primer
(F):5'- AGGTCAGGCTCAGTCTGCATG -3'
(R):5'- CTCCCCGATGTAAGTGGCAAAC -3'
Posted On 2019-06-26