Incidental Mutation 'R0590:Sema6c'
ID55915
Institutional Source Beutler Lab
Gene Symbol Sema6c
Ensembl Gene ENSMUSG00000038777
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
SynonymsSema Y, Semay
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R0590 (G1)
Quality Score95
Status Validated
Chromosome3
Chromosomal Location95160457-95174024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95172623 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 711 (K711E)
Ref Sequence ENSEMBL: ENSMUSP00000144039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090821] [ENSMUST00000090823] [ENSMUST00000107217] [ENSMUST00000131620] [ENSMUST00000142449] [ENSMUST00000168321] [ENSMUST00000202315] [ENSMUST00000204709]
Predicted Effect probably damaging
Transcript: ENSMUST00000090821
AA Change: K711E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088331
Gene: ENSMUSG00000038777
AA Change: K711E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090823
AA Change: K743E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088333
Gene: ENSMUSG00000038777
AA Change: K743E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107217
AA Change: K703E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102835
Gene: ENSMUSG00000038777
AA Change: K703E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 448 1.23e-126 SMART
low complexity region 551 563 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 652 661 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
low complexity region 899 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130662
Predicted Effect probably benign
Transcript: ENSMUST00000131620
SMART Domains Protein: ENSMUSP00000138154
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141607
Predicted Effect probably benign
Transcript: ENSMUST00000142449
SMART Domains Protein: ENSMUSP00000123457
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168321
AA Change: K743E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129081
Gene: ENSMUSG00000038777
AA Change: K743E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202315
AA Change: K711E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144039
Gene: ENSMUSG00000038777
AA Change: K711E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204709
SMART Domains Protein: ENSMUSP00000144702
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
PDB:3OKY|B 25 117 8e-8 PDB
Blast:Sema 62 119 9e-34 BLAST
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display a decrease in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Sema6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Sema6c APN 3 95172398 missense probably damaging 1.00
IGL01631:Sema6c APN 3 95170403 missense probably benign 0.10
IGL01799:Sema6c APN 3 95170831 missense probably damaging 1.00
IGL02237:Sema6c APN 3 95170119 missense probably damaging 1.00
IGL02852:Sema6c APN 3 95169984 splice site probably benign
IGL02874:Sema6c APN 3 95170377 missense probably damaging 1.00
IGL03003:Sema6c APN 3 95169614 missense probably damaging 1.00
PIT4418001:Sema6c UTSW 3 95170090 missense possibly damaging 0.57
R0558:Sema6c UTSW 3 95168691 missense probably damaging 1.00
R0582:Sema6c UTSW 3 95169197 missense probably damaging 1.00
R0685:Sema6c UTSW 3 95172710 missense possibly damaging 0.46
R1056:Sema6c UTSW 3 95171216 missense probably benign 0.15
R1721:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1867:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1868:Sema6c UTSW 3 95170813 missense probably damaging 0.99
R2016:Sema6c UTSW 3 95171234 missense probably benign 0.00
R2343:Sema6c UTSW 3 95167083 missense probably damaging 1.00
R2898:Sema6c UTSW 3 95172818 missense probably damaging 1.00
R4095:Sema6c UTSW 3 95173194 missense probably benign 0.03
R4999:Sema6c UTSW 3 95168363 missense probably damaging 1.00
R5263:Sema6c UTSW 3 95173152 missense probably benign 0.02
R6914:Sema6c UTSW 3 95173208 missense probably benign 0.00
R6942:Sema6c UTSW 3 95173208 missense probably benign 0.00
R7104:Sema6c UTSW 3 95168845 missense possibly damaging 0.95
R7524:Sema6c UTSW 3 95167060 missense probably benign 0.20
R7724:Sema6c UTSW 3 95173199 missense probably damaging 1.00
R8045:Sema6c UTSW 3 95173224 missense probably benign 0.27
Z1177:Sema6c UTSW 3 95168328 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGCATCACCTACCCTAAAGCTG -3'
(R):5'- AGAGGTTCGCTACCCTTCCTGG -3'

Sequencing Primer
(F):5'- CGTCGGAGCAAGGACATC -3'
(R):5'- AGGTAGCGCAGCAGTTC -3'
Posted On2013-07-11