Incidental Mutation 'R7184:Dnah14'
ID559153
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7184 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 181704529 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 2294 (R2294*)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000208001
AA Change: R2294*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGTACAGTGCCAATTAACGTTTC -3'
(R):5'- AGGAGAGACTGGGAGAATACTTTTC -3'

Sequencing Primer
(F):5'- TTCTCCATTTTAAAACAGAAAAGCAG -3'
(R):5'- CGCAGTTTTACCAGACAA -3'
Posted On2019-06-26