Incidental Mutation 'R7184:Slc7a14'
ID 559159
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 045236-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R7184 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 31257007-31364527 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31281212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 366 (G366D)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: G366D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: G366D

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108245
AA Change: G366D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: G366D

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,094,219 (GRCm39) S500P possibly damaging Het
Aldh9a1 T A 1: 167,184,965 (GRCm39) N292K probably benign Het
Art2b A T 7: 101,229,658 (GRCm39) S80R probably benign Het
Atp6v1b2 G T 8: 69,555,219 (GRCm39) A194S possibly damaging Het
Bsnd T C 4: 106,349,109 (GRCm39) M44V probably damaging Het
Cadps2 A T 6: 23,583,428 (GRCm39) V383E probably benign Het
Cd93 T C 2: 148,284,459 (GRCm39) T296A possibly damaging Het
Cdk15 G T 1: 59,304,814 (GRCm39) E138D probably benign Het
Cdon A G 9: 35,375,191 (GRCm39) I406V probably benign Het
Cfhr4 A G 1: 139,660,822 (GRCm39) V622A possibly damaging Het
Cyp3a41a A G 5: 145,642,663 (GRCm39) V232A probably benign Het
Dbndd1 T A 8: 124,235,860 (GRCm39) D130V probably damaging Het
Dnah14 C T 1: 181,532,094 (GRCm39) R2294* probably null Het
Eddm3b A G 14: 51,354,387 (GRCm39) Y125C probably damaging Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Enah A T 1: 181,749,957 (GRCm39) V294E probably damaging Het
Farp2 A G 1: 93,531,137 (GRCm39) E545G probably damaging Het
Farsb T C 1: 78,458,994 (GRCm39) E22G possibly damaging Het
Fcsk G A 8: 111,613,788 (GRCm39) P758S probably damaging Het
Fezf1 A G 6: 23,247,835 (GRCm39) V80A probably benign Het
Fpr2 T C 17: 18,113,533 (GRCm39) Y39H unknown Het
Fsd1l C A 4: 53,694,054 (GRCm39) R344S probably damaging Het
Fxyd1 G T 7: 30,751,401 (GRCm39) R90S unknown Het
Galnt4 T A 10: 98,944,466 (GRCm39) Y64N probably damaging Het
Gatb C T 3: 85,544,258 (GRCm39) Q409* probably null Het
Glipr2 A C 4: 43,968,667 (GRCm39) D73A possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gpr88 C T 3: 116,045,643 (GRCm39) V223I possibly damaging Het
Gtf2h3 A G 5: 124,722,067 (GRCm39) N55S probably benign Het
Htr4 T A 18: 62,570,498 (GRCm39) C184* probably null Het
Ighv6-3 T A 12: 114,355,475 (GRCm39) R71S probably benign Het
Itpr2 G C 6: 146,212,585 (GRCm39) I1510M possibly damaging Het
Keap1 T C 9: 21,145,134 (GRCm39) Q292R probably benign Het
Mab21l4 T C 1: 93,082,237 (GRCm39) N294S probably benign Het
Malt1 A C 18: 65,580,764 (GRCm39) E219D probably benign Het
Manba T C 3: 135,228,915 (GRCm39) V279A possibly damaging Het
Map4k5 T A 12: 69,921,095 (GRCm39) H41L probably benign Het
Mcm2 T G 6: 88,868,776 (GRCm39) Y327S probably damaging Het
Nectin3 A G 16: 46,215,484 (GRCm39) I503T possibly damaging Het
Nqo1 T C 8: 108,119,279 (GRCm39) I99M probably damaging Het
Nrxn2 A G 19: 6,540,582 (GRCm39) H845R probably damaging Het
Otogl C T 10: 107,599,061 (GRCm39) C2254Y probably damaging Het
Pmm1 T C 15: 81,840,415 (GRCm39) N110S probably damaging Het
Poc1b G T 10: 98,970,199 (GRCm39) C68F probably benign Het
Polr1b A G 2: 128,965,842 (GRCm39) Y828C possibly damaging Het
Prl3d1 A G 13: 27,282,619 (GRCm39) H119R probably damaging Het
Pum3 A G 19: 27,403,412 (GRCm39) S30P probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rusc1 T C 3: 88,999,194 (GRCm39) E196G possibly damaging Het
Sf3a3 A G 4: 124,608,772 (GRCm39) K29E probably benign Het
Slc13a1 A T 6: 24,092,311 (GRCm39) I475K probably damaging Het
Slc26a5 G T 5: 22,042,244 (GRCm39) Y237* probably null Het
Tbc1d5 A G 17: 51,107,110 (GRCm39) V482A probably benign Het
Tdrd5 G T 1: 156,087,505 (GRCm39) Q883K probably benign Het
Tet2 T C 3: 133,179,391 (GRCm39) Y1258C probably damaging Het
Upf2 A G 2: 6,028,131 (GRCm39) D739G unknown Het
Vmn1r122 A T 7: 20,867,820 (GRCm39) F78L probably benign Het
Vmn1r75 A T 7: 11,614,915 (GRCm39) K216* probably null Het
Vmn2r11 A T 5: 109,201,281 (GRCm39) Y408N probably damaging Het
Wscd1 T A 11: 71,679,543 (GRCm39) V472D probably damaging Het
Zdbf2 G T 1: 63,345,664 (GRCm39) V1348F possibly damaging Het
Zfp442 G T 2: 150,250,056 (GRCm39) H615Q possibly damaging Het
Zfp457 C A 13: 67,442,065 (GRCm39) C170F possibly damaging Het
Zscan10 A G 17: 23,826,003 (GRCm39) probably null Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31,292,827 (GRCm39) missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31,311,912 (GRCm39) missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31,292,919 (GRCm39) missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31,291,558 (GRCm39) missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31,277,664 (GRCm39) missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31,281,209 (GRCm39) missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31,278,267 (GRCm39) missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31,291,598 (GRCm39) missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31,291,511 (GRCm39) splice site probably benign
R2057:Slc7a14 UTSW 3 31,291,645 (GRCm39) missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31,284,469 (GRCm39) missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31,291,650 (GRCm39) missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31,291,623 (GRCm39) missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31,311,831 (GRCm39) missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31,284,547 (GRCm39) missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31,291,615 (GRCm39) missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31,291,514 (GRCm39) splice site probably null
R5345:Slc7a14 UTSW 3 31,278,006 (GRCm39) missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31,311,919 (GRCm39) missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31,278,346 (GRCm39) missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31,278,059 (GRCm39) missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31,292,856 (GRCm39) missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31,311,719 (GRCm39) missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31,263,385 (GRCm39) missense probably benign
R6020:Slc7a14 UTSW 3 31,278,261 (GRCm39) missense probably benign
R6107:Slc7a14 UTSW 3 31,311,759 (GRCm39) missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31,291,697 (GRCm39) missense probably benign
R6491:Slc7a14 UTSW 3 31,278,093 (GRCm39) missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31,278,372 (GRCm39) missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31,277,728 (GRCm39) missense possibly damaging 0.90
R7271:Slc7a14 UTSW 3 31,278,384 (GRCm39) missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31,281,302 (GRCm39) missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31,311,880 (GRCm39) missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31,263,361 (GRCm39) missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31,281,300 (GRCm39) missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31,278,282 (GRCm39) missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31,311,759 (GRCm39) missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31,277,595 (GRCm39) missense probably damaging 0.98
R9011:Slc7a14 UTSW 3 31,278,345 (GRCm39) missense probably damaging 1.00
R9208:Slc7a14 UTSW 3 31,281,359 (GRCm39) missense probably damaging 1.00
R9633:Slc7a14 UTSW 3 31,278,166 (GRCm39) missense probably benign 0.31
Z1088:Slc7a14 UTSW 3 31,278,148 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGGGCACAGATCAGTTGGTTC -3'
(R):5'- TGTTTTCACAGGTGAGCATGATC -3'

Sequencing Primer
(F):5'- CACAGATCAGTTGGTTCTGGAC -3'
(R):5'- CAGGTGAGCATGATCTTAACCCTG -3'
Posted On 2019-06-26