Mutagenetix > Incidental Mutations

Incidental Mutation 'R7184:Slc7a14'

559159

Institutional Source

Beutler Lab

Gene Symbol

Slc7a14

Ensembl Gene

ENSMUSG00000069072

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 14

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.179) question?

Stock #

R7184 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31202858-31310378 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31227063 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 366 (G366D)

Ref Sequence

ENSEMBL: ENSMUSP00000088803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091259
AA Change: G366D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: G366D

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	443	2.1e-44	PFAM
Pfam:AA_permease	57	436	7.2e-38	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	677	9.2e-21	PFAM
low complexity region	737	757	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108245
AA Change: G366D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: G366D

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	445	2.5e-46	PFAM
Pfam:AA_permease	57	437	6.9e-41	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	668	1.4e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,154,515	N294S	probably benign	Het
Aass	A	G	6: 23,094,220	S500P	possibly damaging	Het
Aldh9a1	T	A	1: 167,357,396	N292K	probably benign	Het
Art2b	A	T	7: 101,580,451	S80R	probably benign	Het
Atp6v1b2	G	T	8: 69,102,567	A194S	possibly damaging	Het
Bsnd	T	C	4: 106,491,912	M44V	probably damaging	Het
Cadps2	A	T	6: 23,583,429	V383E	probably benign	Het
Cd93	T	C	2: 148,442,539	T296A	possibly damaging	Het
Cdk15	G	T	1: 59,265,655	E138D	probably benign	Het
Cdon	A	G	9: 35,463,895	I406V	probably benign	Het
Cyp3a41a	A	G	5: 145,705,853	V232A	probably benign	Het
Dbndd1	T	A	8: 123,509,121	D130V	probably damaging	Het
Dnah14	C	T	1: 181,704,529	R2294*	probably null	Het
Eddm3b	A	G	14: 51,116,930	Y125C	probably damaging	Het
Enah	A	T	1: 181,922,392	V294E	probably damaging	Het
Farp2	A	G	1: 93,603,415	E545G	probably damaging	Het
Farsb	T	C	1: 78,482,357	E22G	possibly damaging	Het
Fezf1	A	G	6: 23,247,836	V80A	probably benign	Het
Fpr2	T	C	17: 17,893,271	Y39H	unknown	Het
Fsd1l	C	A	4: 53,694,054	R344S	probably damaging	Het
Fuk	G	A	8: 110,887,156	P758S	probably damaging	Het
Fxyd1	G	T	7: 31,051,976	R90S	unknown	Het
Galnt4	T	A	10: 99,108,604	Y64N	probably damaging	Het
Gatb	C	T	3: 85,636,951	Q409*	probably null	Het
Glipr2	A	C	4: 43,968,667	D73A	possibly damaging	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gm40460	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,713		probably benign	Het
Gm4788	A	G	1: 139,733,084	V622A	possibly damaging	Het
Gpr88	C	T	3: 116,251,994	V223I	possibly damaging	Het
Gtf2h3	A	G	5: 124,584,004	N55S	probably benign	Het
Htr4	T	A	18: 62,437,427	C184*	probably null	Het
Ighv6-3	T	A	12: 114,391,855	R71S	probably benign	Het
Itpr2	G	C	6: 146,311,087	I1510M	possibly damaging	Het
Keap1	T	C	9: 21,233,838	Q292R	probably benign	Het
Malt1	A	C	18: 65,447,693	E219D	probably benign	Het
Manba	T	C	3: 135,523,154	V279A	possibly damaging	Het
Map4k5	T	A	12: 69,874,321	H41L	probably benign	Het
Mcm2	T	G	6: 88,891,794	Y327S	probably damaging	Het
Nectin3	A	G	16: 46,395,121	I503T	possibly damaging	Het
Nqo1	T	C	8: 107,392,647	I99M	probably damaging	Het
Nrxn2	A	G	19: 6,490,552	H845R	probably damaging	Het
Otogl	C	T	10: 107,763,200	C2254Y	probably damaging	Het
Pmm1	T	C	15: 81,956,214	N110S	probably damaging	Het
Poc1b	G	T	10: 99,134,337	C68F	probably benign	Het
Polr1b	A	G	2: 129,123,922	Y828C	possibly damaging	Het
Prl3d1	A	G	13: 27,098,636	H119R	probably damaging	Het
Pum3	A	G	19: 27,426,012	S30P	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rusc1	T	C	3: 89,091,887	E196G	possibly damaging	Het
Sf3a3	A	G	4: 124,714,979	K29E	probably benign	Het
Slc13a1	A	T	6: 24,092,312	I475K	probably damaging	Het
Slc26a5	G	T	5: 21,837,246	Y237*	probably null	Het
Tbc1d5	A	G	17: 50,800,082	V482A	probably benign	Het
Tdrd5	G	T	1: 156,259,935	Q883K	probably benign	Het
Tet2	T	C	3: 133,473,630	Y1258C	probably damaging	Het
Upf2	A	G	2: 6,023,320	D739G	unknown	Het
Vmn1r122	A	T	7: 21,133,895	F78L	probably benign	Het
Vmn1r75	A	T	7: 11,880,988	K216*	probably null	Het
Vmn2r11	A	T	5: 109,053,415	Y408N	probably damaging	Het
Wscd1	T	A	11: 71,788,717	V472D	probably damaging	Het
Zdbf2	G	T	1: 63,306,505	V1348F	possibly damaging	Het
Zfp442	G	T	2: 150,408,136	H615Q	possibly damaging	Het
Zfp457	C	A	13: 67,294,001	C170F	possibly damaging	Het
Zscan10	A	G	17: 23,607,029		probably null	Het

Other mutations in Slc7a14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02631:Slc7a14	APN	3	31238678	missense	probably damaging	1.00
IGL02713:Slc7a14	APN	3	31257763	missense	probably damaging	0.96
IGL03341:Slc7a14	APN	3	31238770	missense	probably damaging	1.00
IGL03350:Slc7a14	APN	3	31237409	missense	probably benign	0.35
IGL03379:Slc7a14	APN	3	31223515	missense	probably damaging	1.00
R0064:Slc7a14	UTSW	3	31227060	missense	probably damaging	1.00
R1549:Slc7a14	UTSW	3	31224118	missense	possibly damaging	0.94
R1591:Slc7a14	UTSW	3	31237449	missense	probably damaging	1.00
R2054:Slc7a14	UTSW	3	31237362	splice site	probably benign
R2057:Slc7a14	UTSW	3	31237496	missense	probably damaging	1.00
R2442:Slc7a14	UTSW	3	31230320	missense	probably damaging	1.00
R2504:Slc7a14	UTSW	3	31237501	missense	possibly damaging	0.85
R3848:Slc7a14	UTSW	3	31237474	missense	probably damaging	1.00
R4653:Slc7a14	UTSW	3	31257682	missense	probably damaging	1.00
R4702:Slc7a14	UTSW	3	31230398	missense	probably damaging	1.00
R5043:Slc7a14	UTSW	3	31237466	missense	probably damaging	1.00
R5187:Slc7a14	UTSW	3	31237365	splice site	probably null
R5345:Slc7a14	UTSW	3	31223857	missense	probably damaging	0.99
R5393:Slc7a14	UTSW	3	31257770	missense	probably damaging	1.00
R5421:Slc7a14	UTSW	3	31224197	missense	probably damaging	1.00
R5736:Slc7a14	UTSW	3	31223910	missense	probably benign	0.00
R5771:Slc7a14	UTSW	3	31238707	missense	probably damaging	1.00
R5896:Slc7a14	UTSW	3	31257570	missense	probably damaging	1.00
R5996:Slc7a14	UTSW	3	31209236	missense	probably benign
R6020:Slc7a14	UTSW	3	31224112	missense	probably benign
R6107:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R6140:Slc7a14	UTSW	3	31237548	missense	probably benign
R6491:Slc7a14	UTSW	3	31223944	missense	probably damaging	1.00
R6846:Slc7a14	UTSW	3	31224223	missense	probably damaging	1.00
R6990:Slc7a14	UTSW	3	31223579	missense	possibly damaging	0.90
R7271:Slc7a14	UTSW	3	31224235	missense	probably damaging	1.00
R7282:Slc7a14	UTSW	3	31227153	missense	possibly damaging	0.67
R7331:Slc7a14	UTSW	3	31257731	missense	probably benign	0.00
R8227:Slc7a14	UTSW	3	31209212	missense	probably benign	0.00
R8238:Slc7a14	UTSW	3	31227151	missense	probably benign	0.01
R8524:Slc7a14	UTSW	3	31224133	missense	possibly damaging	0.70
R8843:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R8903:Slc7a14	UTSW	3	31223446	missense	probably damaging	0.98
Z1088:Slc7a14	UTSW	3	31223999	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGGGCACAGATCAGTTGGTTC -3'
(R):5'- TGTTTTCACAGGTGAGCATGATC -3'

Sequencing Primer
(F):5'- CACAGATCAGTTGGTTCTGGAC -3'
(R):5'- CAGGTGAGCATGATCTTAACCCTG -3'

Posted On

2019-06-26