Incidental Mutation 'R7184:Sf3a3'
ID 559168
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Name splicing factor 3a, subunit 3
Synonyms 4930512K19Rik, 60kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R7184 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 124714776-124732460 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124714979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 29 (K29E)
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
AlphaFold Q9D554
Predicted Effect probably benign
Transcript: ENSMUST00000030734
AA Change: K29E

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902
AA Change: K29E

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
PIT4495001:Sf3a3 UTSW 4 124728320 missense probably damaging 1.00
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R1943:Sf3a3 UTSW 4 124715901 missense possibly damaging 0.95
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R2984:Sf3a3 UTSW 4 124718409 missense probably damaging 1.00
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4366:Sf3a3 UTSW 4 124725139 missense probably benign
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5464:Sf3a3 UTSW 4 124728240 critical splice donor site probably null
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7157:Sf3a3 UTSW 4 124722900 missense probably damaging 0.98
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
R9212:Sf3a3 UTSW 4 124728128 missense possibly damaging 0.67
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AACTTTGGTGCAGCCGGATG -3'
(R):5'- CGCTTATTGGTTTAGGTCCCAG -3'

Sequencing Primer
(F):5'- ATGCTGCGCGCTGAGAC -3'
(R):5'- TTAGGTCCCAGGGGCTGAAG -3'
Posted On 2019-06-26