Incidental Mutation 'R7184:Cdon'
ID559189
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R7184 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35463895 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 406 (I406V)
Ref Sequence ENSEMBL: ENSMUSP00000045547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129] [ENSMUST00000154652]
Predicted Effect probably benign
Transcript: ENSMUST00000042842
AA Change: I406V

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: I406V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119129
AA Change: I406V

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: I406V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127264
AA Change: I70V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115216
Gene: ENSMUSG00000038119
AA Change: I70V

DomainStartEndE-ValueType
IGc2 1 51 6.26e-5 SMART
IG_like 18 62 1.06e2 SMART
IGc2 81 134 6.45e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154652
AA Change: I406V

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117499
Gene: ENSMUSG00000038119
AA Change: I406V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGAAACATTCTGCTTCCAG -3'
(R):5'- ATGAGGTAGACAGGCTCCAG -3'

Sequencing Primer
(F):5'- GAAACATTCTGCTTCCAGTTGTCAG -3'
(R):5'- TAGACAGGCTCCAGGTCCAG -3'
Posted On2019-06-26