Incidental Mutation 'R7185:Cdc14a'
ID559222
Institutional Source Beutler Lab
Gene Symbol Cdc14a
Ensembl Gene ENSMUSG00000033502
Gene NameCDC14 cell division cycle 14A
SynonymsCDC14A2, Cdc14, CDC14a1, A830059A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116272553-116424032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116294027 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 494 (E494G)
Ref Sequence ENSEMBL: ENSMUSP00000087950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090464] [ENSMUST00000106491]
Predicted Effect probably benign
Transcript: ENSMUST00000090464
AA Change: E494G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087950
Gene: ENSMUSG00000033502
AA Change: E494G

DomainStartEndE-ValueType
Pfam:DSPn 13 153 1.6e-66 PFAM
Pfam:Y_phosphatase 210 324 1.1e-7 PFAM
Pfam:DSPc 214 328 1.8e-14 PFAM
low complexity region 539 558 N/A INTRINSIC
low complexity region 573 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106491
AA Change: E445G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102100
Gene: ENSMUSG00000033502
AA Change: E445G

DomainStartEndE-ValueType
Pfam:DSPn 12 121 9.5e-44 PFAM
Pfam:Y_phosphatase 160 274 6.4e-8 PFAM
Pfam:DSPc 160 280 2.8e-14 PFAM
low complexity region 490 509 N/A INTRINSIC
low complexity region 524 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Cdc14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cdc14a APN 3 116294844 nonsense probably null
IGL01062:Cdc14a APN 3 116274712 splice site probably benign
IGL01584:Cdc14a APN 3 116392825 nonsense probably null
IGL03084:Cdc14a APN 3 116348452 critical splice donor site probably null
IGL03237:Cdc14a APN 3 116404626 intron probably benign
IGL03296:Cdc14a APN 3 116297158 missense probably benign 0.02
PIT4131001:Cdc14a UTSW 3 116328661 missense possibly damaging 0.66
R0707:Cdc14a UTSW 3 116293713 splice site probably benign
R0782:Cdc14a UTSW 3 116322136 missense probably damaging 1.00
R0835:Cdc14a UTSW 3 116328522 missense probably benign 0.12
R1363:Cdc14a UTSW 3 116293860 small deletion probably benign
R1507:Cdc14a UTSW 3 116293997 missense possibly damaging 0.47
R1545:Cdc14a UTSW 3 116293724 critical splice donor site probably null
R1795:Cdc14a UTSW 3 116298473 missense possibly damaging 0.81
R1797:Cdc14a UTSW 3 116322194 missense probably damaging 1.00
R1830:Cdc14a UTSW 3 116422647 nonsense probably null
R4229:Cdc14a UTSW 3 116293764 missense probably damaging 0.99
R4655:Cdc14a UTSW 3 116328487 missense probably damaging 1.00
R4769:Cdc14a UTSW 3 116294750 critical splice donor site probably null
R4870:Cdc14a UTSW 3 116423460 missense probably benign 0.30
R4980:Cdc14a UTSW 3 116392857 nonsense probably null
R6228:Cdc14a UTSW 3 116351213 missense probably damaging 1.00
R6248:Cdc14a UTSW 3 116308194 missense probably benign 0.01
R6402:Cdc14a UTSW 3 116348459 missense probably damaging 1.00
R6749:Cdc14a UTSW 3 116297158 missense possibly damaging 0.68
R6852:Cdc14a UTSW 3 116328676 missense possibly damaging 0.94
R6996:Cdc14a UTSW 3 116328706 missense probably damaging 1.00
R7783:Cdc14a UTSW 3 116404587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGGAATCTCACTGAGG -3'
(R):5'- GCCGATTAGTCAACTGTGTGG -3'

Sequencing Primer
(F):5'- TGTTCAGGTTGCCCCCAAGAC -3'
(R):5'- TCAACTGTGTGGATCAGAACTG -3'
Posted On2019-06-26