Incidental Mutation 'R7185:Olfr71'
ID559223
Institutional Source Beutler Lab
Gene Symbol Olfr71
Ensembl Gene ENSMUSG00000046450
Gene Nameolfactory receptor 71
SynonymsGA_x6K02T2N78B-16230286-16231224, mOR17, MOR262-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43704562-43710255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43706082 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 162 (I162T)
Ref Sequence ENSEMBL: ENSMUSP00000103494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055401] [ENSMUST00000107862] [ENSMUST00000217544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055401
AA Change: I162T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060230
Gene: ENSMUSG00000046450
AA Change: I162T

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-34 PFAM
Pfam:7tm_4 139 283 4.5e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107862
AA Change: I162T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103494
Gene: ENSMUSG00000046450
AA Change: I162T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-52 PFAM
Pfam:7tm_1 41 290 7.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217544
AA Change: I162T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Olfr71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Olfr71 APN 4 43706172 missense probably damaging 1.00
PIT4453001:Olfr71 UTSW 4 43706464 missense probably damaging 1.00
R0597:Olfr71 UTSW 4 43706592 unclassified probably null
R0610:Olfr71 UTSW 4 43706400 missense possibly damaging 0.69
R1588:Olfr71 UTSW 4 43705923 missense probably damaging 0.98
R1619:Olfr71 UTSW 4 43706292 missense probably damaging 1.00
R1779:Olfr71 UTSW 4 43706041 missense probably damaging 1.00
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R4723:Olfr71 UTSW 4 43705785 missense probably damaging 1.00
R4891:Olfr71 UTSW 4 43706194 missense probably damaging 0.99
R5049:Olfr71 UTSW 4 43706259 missense probably damaging 1.00
R5151:Olfr71 UTSW 4 43706518 missense probably damaging 0.99
R5491:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
R5521:Olfr71 UTSW 4 43705788 missense possibly damaging 0.88
R6225:Olfr71 UTSW 4 43705698 missense probably damaging 1.00
R6518:Olfr71 UTSW 4 43706334 missense probably benign 0.05
R6883:Olfr71 UTSW 4 43705723 missense possibly damaging 0.93
R7339:Olfr71 UTSW 4 43706080 missense probably benign 0.05
R7502:Olfr71 UTSW 4 43706316 missense probably damaging 0.97
X0017:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
X0021:Olfr71 UTSW 4 43706326 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGGATCAGCATGTAGGAC -3'
(R):5'- GAAGACCATCTCCTTTACGGGC -3'

Sequencing Primer
(F):5'- TAGGACAGGCAGATGAGGGTC -3'
(R):5'- AGATGTGTCTGAGCCTCTCCAC -3'
Posted On2019-06-26