Incidental Mutation 'R7185:Xpa'
ID559224
Institutional Source Beutler Lab
Gene Symbol Xpa
Ensembl Gene ENSMUSG00000028329
Gene Namexeroderma pigmentosum, complementation group A
SynonymsXpac
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46155347-46196311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46183078 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 237 (T237K)
Ref Sequence ENSEMBL: ENSMUSP00000121850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030013] [ENSMUST00000058232] [ENSMUST00000132358] [ENSMUST00000142380]
Predicted Effect probably benign
Transcript: ENSMUST00000030013
SMART Domains Protein: ENSMUSP00000030013
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058232
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132358
SMART Domains Protein: ENSMUSP00000138512
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
Pfam:XPA_N 1 23 1.1e-13 PFAM
Pfam:XPA_C 24 76 7.9e-29 PFAM
low complexity region 103 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142380
AA Change: T237K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121850
Gene: ENSMUSG00000028329
AA Change: T237K

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mutants are highly susceptible to tumors induced by UV (skin and ocular tumors), 7,12-dimethylbenz[a]anthracene (skin tumors), benzo[a]pyrene (pulmonary tumors), 4-nitroquinoline-1-oxide (tongue tumors) and aflatoxin B(1) (liver tumors). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Xpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Xpa APN 4 46185606 missense probably damaging 1.00
IGL02670:Xpa APN 4 46185682 missense probably benign 0.03
R1863:Xpa UTSW 4 46155730 intron probably benign
R2149:Xpa UTSW 4 46183189 missense probably damaging 0.99
R4534:Xpa UTSW 4 46185624 missense probably benign 0.00
R5308:Xpa UTSW 4 46185659 missense probably benign 0.00
R6647:Xpa UTSW 4 46183089 missense probably benign 0.00
R7157:Xpa UTSW 4 46185612 missense probably damaging 1.00
R8191:Xpa UTSW 4 46183225 missense possibly damaging 0.56
R8219:Xpa UTSW 4 46183150 missense probably benign 0.02
Z1177:Xpa UTSW 4 46183036 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTGATGCCTAATCCCACTGTC -3'
(R):5'- GTGAGCTCGACAGTTAGGAC -3'

Sequencing Primer
(F):5'- GATGCCTAATCCCACTGTCCCTAC -3'
(R):5'- TCTGAACCCCAGCTGACTG -3'
Posted On2019-06-26