Incidental Mutation 'R0590:Phf14'
ID 55923
Institutional Source Beutler Lab
Gene Symbol Phf14
Ensembl Gene ENSMUSG00000029629
Gene Name PHD finger protein 14
Synonyms 5730446A07Rik, 4932409F11Rik, 1110001C23Rik
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0590 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 11907809-12081205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11961578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 405 (V405I)
Ref Sequence ENSEMBL: ENSMUSP00000111173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090632
AA Change: V405I

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: V405I

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115510
AA Change: V405I

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: V405I

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115511
AA Change: V405I

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: V405I

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
RING 315 381 1.21e1 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
RING 721 769 2.63e0 SMART
low complexity region 830 848 N/A INTRINSIC
PHD 863 912 9.92e-9 SMART
RING 864 911 3.17e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000133776
AA Change: V130I
SMART Domains Protein: ENSMUSP00000115485
Gene: ENSMUSG00000029629
AA Change: V130I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PHD 40 97 1.64e-9 SMART
PHD 159 218 1.18e-6 SMART
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Phf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Phf14 APN 6 11941424 splice site probably benign
IGL01120:Phf14 APN 6 11962740 missense probably damaging 1.00
IGL01575:Phf14 APN 6 11990051 missense probably damaging 1.00
IGL02153:Phf14 APN 6 11934016 missense probably damaging 0.99
IGL02735:Phf14 APN 6 11987612 missense probably benign 0.21
IGL03294:Phf14 APN 6 11953367 missense probably damaging 1.00
IGL03392:Phf14 APN 6 11962659 missense probably damaging 1.00
G1Funyon:Phf14 UTSW 6 11992062 missense probably damaging 0.97
R0060:Phf14 UTSW 6 11953317 missense probably damaging 0.97
R0099:Phf14 UTSW 6 11987697 unclassified probably benign
R0384:Phf14 UTSW 6 11997020 splice site probably benign
R0433:Phf14 UTSW 6 11933743 missense probably damaging 1.00
R0563:Phf14 UTSW 6 11933601 intron probably benign
R1066:Phf14 UTSW 6 11987255 missense possibly damaging 0.47
R1187:Phf14 UTSW 6 11941496 missense probably damaging 0.97
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1491:Phf14 UTSW 6 11941479 missense possibly damaging 0.80
R1543:Phf14 UTSW 6 11987683 critical splice donor site probably null
R1595:Phf14 UTSW 6 11988753 missense possibly damaging 0.69
R1861:Phf14 UTSW 6 11987611 missense probably benign 0.00
R2289:Phf14 UTSW 6 12047846 missense probably damaging 1.00
R2437:Phf14 UTSW 6 11962658 missense probably damaging 1.00
R3831:Phf14 UTSW 6 11933874 splice site probably null
R3832:Phf14 UTSW 6 11933874 splice site probably null
R3833:Phf14 UTSW 6 11933874 splice site probably null
R4290:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4293:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4294:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4295:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4572:Phf14 UTSW 6 12006824 missense probably damaging 1.00
R4663:Phf14 UTSW 6 11953422 missense possibly damaging 0.92
R4673:Phf14 UTSW 6 11992057 missense probably damaging 1.00
R4882:Phf14 UTSW 6 11988757 missense possibly damaging 0.88
R4954:Phf14 UTSW 6 11987620 missense probably benign 0.09
R5148:Phf14 UTSW 6 11961642 missense possibly damaging 0.72
R5284:Phf14 UTSW 6 11997120 missense probably damaging 0.99
R5569:Phf14 UTSW 6 11934016 missense probably damaging 0.99
R5694:Phf14 UTSW 6 11990125 missense possibly damaging 0.68
R5726:Phf14 UTSW 6 11933538 intron probably benign
R5730:Phf14 UTSW 6 11953320 missense possibly damaging 0.54
R5819:Phf14 UTSW 6 11997252 splice site probably null
R5915:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R6578:Phf14 UTSW 6 11991997 missense probably damaging 1.00
R6950:Phf14 UTSW 6 12006855 missense probably damaging 1.00
R7181:Phf14 UTSW 6 11933341 missense unknown
R7352:Phf14 UTSW 6 11961638 missense probably damaging 1.00
R7355:Phf14 UTSW 6 12081007 missense probably benign 0.01
R7947:Phf14 UTSW 6 11933307 missense unknown
R8110:Phf14 UTSW 6 11953423 missense possibly damaging 0.91
R8283:Phf14 UTSW 6 11987637 missense probably benign 0.20
R8301:Phf14 UTSW 6 11992062 missense probably damaging 0.97
R8688:Phf14 UTSW 6 11990035 missense probably damaging 0.98
R9343:Phf14 UTSW 6 11961564 missense probably damaging 1.00
R9402:Phf14 UTSW 6 11933780 missense possibly damaging 0.49
R9434:Phf14 UTSW 6 11933493 missense unknown
X0025:Phf14 UTSW 6 11926813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCTTGAAAAGTAATGCTCACTGC -3'
(R):5'- ATGCCTGAAGCTGACCTGAGCTAC -3'

Sequencing Primer
(F):5'- ATCTGCTATCATTCTCTAGCTATGC -3'
(R):5'- cctgagctacagtgagatattacc -3'
Posted On 2013-07-11