Incidental Mutation 'R7185:Kcnj5'
ID559244
Institutional Source Beutler Lab
Gene Symbol Kcnj5
Ensembl Gene ENSMUSG00000032034
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 5
SynonymsGIRK4, Kir3.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32314707-32344350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32322176 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 281 (N281T)
Ref Sequence ENSEMBL: ENSMUSP00000034533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034533] [ENSMUST00000214223] [ENSMUST00000216033]
Predicted Effect probably damaging
Transcript: ENSMUST00000034533
AA Change: N281T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034533
Gene: ENSMUSG00000032034
AA Change: N281T

DomainStartEndE-ValueType
Pfam:IRK 54 377 7e-147 PFAM
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214223
AA Change: N281T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000216033
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit mild resting tachycardias and reduced muscarinic-gated atrial potassium channel responses to pharmacological stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Kcnj5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Kcnj5 APN 9 32322423 missense probably damaging 1.00
IGL01700:Kcnj5 APN 9 32322629 missense probably damaging 1.00
IGL02250:Kcnj5 APN 9 32317756 missense probably damaging 1.00
IGL02683:Kcnj5 APN 9 32317780 missense possibly damaging 0.94
IGL02981:Kcnj5 APN 9 32322581 missense probably damaging 1.00
R0388:Kcnj5 UTSW 9 32317863 missense probably damaging 1.00
R0464:Kcnj5 UTSW 9 32322973 missense possibly damaging 0.87
R0524:Kcnj5 UTSW 9 32322974 missense probably benign 0.16
R1711:Kcnj5 UTSW 9 32322569 missense probably damaging 1.00
R1730:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R1783:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R2203:Kcnj5 UTSW 9 32322900 missense probably benign 0.43
R2424:Kcnj5 UTSW 9 32322820 missense probably damaging 1.00
R3701:Kcnj5 UTSW 9 32317828 missense possibly damaging 0.95
R4459:Kcnj5 UTSW 9 32322395 missense probably damaging 1.00
R4657:Kcnj5 UTSW 9 32322677 missense probably benign
R5422:Kcnj5 UTSW 9 32317705 missense probably benign 0.00
R6073:Kcnj5 UTSW 9 32317800 missense probably damaging 1.00
R7289:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7294:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7295:Kcnj5 UTSW 9 32322791 missense probably damaging 1.00
R7296:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7450:Kcnj5 UTSW 9 32322195 missense possibly damaging 0.52
R7688:Kcnj5 UTSW 9 32322968 missense probably benign 0.00
R7911:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
Z1177:Kcnj5 UTSW 9 32317698 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGGATTCTTGCACACAAACTTG -3'
(R):5'- AAGCTGTGCCTCATGTTCCG -3'

Sequencing Primer
(F):5'- TTGCACCCTAGAGAGCCC -3'
(R):5'- GCCTCATGTTCCGGGTAG -3'
Posted On2019-06-26