Incidental Mutation 'R0590:Vmn1r23'
ID55925
Institutional Source Beutler Lab
Gene Symbol Vmn1r23
Ensembl Gene ENSMUSG00000093376
Gene Namevomeronasal 1 receptor 23
SynonymsV1rc24
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0590 (G1)
Quality Score211
Status Validated
Chromosome6
Chromosomal Location57925842-57926838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57926364 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 143 (V143A)
Ref Sequence ENSEMBL: ENSMUSP00000135676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175817]
Predicted Effect probably benign
Transcript: ENSMUST00000175817
AA Change: V143A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135676
Gene: ENSMUSG00000093376
AA Change: V143A

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.1e-57 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Vmn1r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Vmn1r23 APN 6 57926076 missense possibly damaging 0.89
IGL01980:Vmn1r23 APN 6 57926490 missense probably damaging 1.00
IGL02934:Vmn1r23 APN 6 57925929 missense probably benign 0.26
IGL03153:Vmn1r23 APN 6 57925932 missense probably damaging 0.98
R0410:Vmn1r23 UTSW 6 57926190 missense probably benign 0.11
R0452:Vmn1r23 UTSW 6 57926484 missense possibly damaging 0.90
R0647:Vmn1r23 UTSW 6 57926184 missense probably benign
R0692:Vmn1r23 UTSW 6 57926125 nonsense probably null
R1674:Vmn1r23 UTSW 6 57926061 missense possibly damaging 0.75
R1744:Vmn1r23 UTSW 6 57925925 missense possibly damaging 0.81
R1774:Vmn1r23 UTSW 6 57926690 missense probably damaging 0.97
R2101:Vmn1r23 UTSW 6 57926452 missense possibly damaging 0.90
R2202:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2204:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2205:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R4282:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R4408:Vmn1r23 UTSW 6 57926368 missense probably benign 0.01
R4532:Vmn1r23 UTSW 6 57925929 missense probably benign 0.21
R4690:Vmn1r23 UTSW 6 57926025 missense probably benign
R4700:Vmn1r23 UTSW 6 57926205 missense probably benign 0.17
R4894:Vmn1r23 UTSW 6 57926325 missense probably benign 0.00
R6164:Vmn1r23 UTSW 6 57926055 missense possibly damaging 0.90
R6930:Vmn1r23 UTSW 6 57926145 missense probably benign
R7129:Vmn1r23 UTSW 6 57926076 missense possibly damaging 0.89
R7731:Vmn1r23 UTSW 6 57926334 missense probably benign 0.03
R7877:Vmn1r23 UTSW 6 57926556 missense probably benign
R8751:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R8809:Vmn1r23 UTSW 6 57926367 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAGGTCTACCCAGTACATGACCAC -3'
(R):5'- TGAGAGGACTCTCTATGGGCATCAC -3'

Sequencing Primer
(F):5'- GCCTGATGCTATGAAGATGC -3'
(R):5'- ATGGGCATCACATGCCTC -3'
Posted On2013-07-11