Incidental Mutation 'R7185:Afmid'
ID559251
Institutional Source Beutler Lab
Gene Symbol Afmid
Ensembl Gene ENSMUSG00000017718
Gene Namearylformamidase
Synonyms9030621K19Rik, formylkynureninase, formylase, kynurenine formamidase, Kf
MMRRC Submission
Accession Numbers

Genbank: NM_027827; MGI: 2448704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117825924-117839908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117834773 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 95 (D95E)
Ref Sequence ENSEMBL: ENSMUSP00000119310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073388] [ENSMUST00000132298] [ENSMUST00000149668]
Predicted Effect probably benign
Transcript: ENSMUST00000073388
AA Change: D103E

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073102
Gene: ENSMUSG00000017718
AA Change: D103E

DomainStartEndE-ValueType
Pfam:COesterase 34 139 1.1e-6 PFAM
Pfam:Abhydrolase_5 88 280 4.1e-12 PFAM
Pfam:Abhydrolase_3 89 283 7.8e-19 PFAM
Pfam:Peptidase_S9 106 296 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149668
AA Change: D95E

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119310
Gene: ENSMUSG00000017718
AA Change: D95E

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 80 272 9.1e-12 PFAM
Pfam:Abhydrolase_3 81 273 1.7e-17 PFAM
Pfam:Peptidase_S9 101 287 2.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit polydipsia, polyuria and hyperglycemia. Mice homozygous for a full exon 2 deletion show impaired glucose tolerance due to reduced insulin secretion associated with reduced islet mass. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(12)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Afmid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Afmid APN 11 117836426 missense probably damaging 0.99
IGL02205:Afmid APN 11 117835156 missense probably damaging 1.00
IGL02657:Afmid APN 11 117834822 missense possibly damaging 0.72
2107:Afmid UTSW 11 117835561 missense probably damaging 1.00
R0371:Afmid UTSW 11 117835140 splice site probably benign
R0907:Afmid UTSW 11 117835590 splice site probably benign
R0941:Afmid UTSW 11 117835245 splice site probably benign
R1915:Afmid UTSW 11 117835799 missense possibly damaging 0.96
R1975:Afmid UTSW 11 117836474 missense probably benign 0.07
R2034:Afmid UTSW 11 117835235 missense probably benign 0.07
R4064:Afmid UTSW 11 117836528 missense probably benign 0.00
R5386:Afmid UTSW 11 117828142 missense probably benign
R5815:Afmid UTSW 11 117835704 missense probably benign 0.17
R7075:Afmid UTSW 11 117835705 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGGCAACATCATGGTCAAGTTG -3'
(R):5'- TGTGCCTGAACAGAGCAAAATG -3'

Sequencing Primer
(F):5'- TCAAACTCACTAAGTAGCTGAGG -3'
(R):5'- AAATGCTGGGTCAGGATCCACC -3'
Posted On2019-06-26