Incidental Mutation 'R7185:Nek10'
ID559261
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14846621 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 245 (K245E)
Ref Sequence ENSEMBL: ENSMUSP00000108249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect probably benign
Transcript: ENSMUST00000112630
AA Change: K245E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: K245E

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112631
AA Change: K245E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: K245E

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224491
AA Change: K245E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 synonymous probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCATGATAGGGAGCATGGCAT -3'
(R):5'- GAGAAGGATGGAAGCAGGGAGA -3'

Sequencing Primer
(F):5'- GAGGGCTTCTATCTTGAGACACAAC -3'
(R):5'- TGGAAGCAGGGAGAGAGAG -3'
Posted On2019-06-26