Incidental Mutation 'R7185:Ptchd4'
ID559266
Institutional Source Beutler Lab
Gene Symbol Ptchd4
Ensembl Gene ENSMUSG00000042256
Gene Namepatched domain containing 4
Synonyms3110082D06Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028474.1; MGI: 1920485

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location42315947-42507741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42503188 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 660 (A660D)
Ref Sequence ENSEMBL: ENSMUSP00000047640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048691]
Predicted Effect probably damaging
Transcript: ENSMUST00000048691
AA Change: A660D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047640
Gene: ENSMUSG00000042256
AA Change: A660D

DomainStartEndE-ValueType
Pfam:Patched 58 867 6.1e-102 PFAM
Pfam:Sterol-sensing 312 464 2.9e-26 PFAM
low complexity region 869 891 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec11c T A 18: 65,814,892 D134E probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Ptchd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ptchd4 APN 17 42316926 nonsense probably null
IGL01360:Ptchd4 APN 17 42317045 missense probably benign 0.09
IGL01814:Ptchd4 APN 17 42503286 missense possibly damaging 0.84
IGL01885:Ptchd4 APN 17 42503602 missense probably damaging 1.00
IGL01929:Ptchd4 APN 17 42503322 missense probably benign 0.02
IGL02371:Ptchd4 APN 17 42316974 missense possibly damaging 0.83
IGL02480:Ptchd4 APN 17 42502540 missense probably benign 0.38
IGL02507:Ptchd4 APN 17 42316873 missense possibly damaging 0.72
IGL02593:Ptchd4 APN 17 42317146 missense probably benign 0.24
IGL02861:Ptchd4 APN 17 42377317 missense probably damaging 1.00
IGL02884:Ptchd4 APN 17 42502449 missense possibly damaging 0.86
IGL03384:Ptchd4 APN 17 42502590 missense probably damaging 1.00
PIT4418001:Ptchd4 UTSW 17 42503089 missense probably damaging 1.00
R0030:Ptchd4 UTSW 17 42317108 nonsense probably null
R0243:Ptchd4 UTSW 17 42503416 missense probably damaging 1.00
R0398:Ptchd4 UTSW 17 42377259 missense possibly damaging 0.95
R0513:Ptchd4 UTSW 17 42503746 missense probably benign 0.14
R0630:Ptchd4 UTSW 17 42377185 missense probably benign 0.17
R0662:Ptchd4 UTSW 17 42502576 missense probably damaging 1.00
R1004:Ptchd4 UTSW 17 42377602 missense probably benign 0.00
R1433:Ptchd4 UTSW 17 42503715 missense possibly damaging 0.75
R1451:Ptchd4 UTSW 17 42502918 missense probably damaging 0.99
R1522:Ptchd4 UTSW 17 42503542 missense probably damaging 1.00
R1901:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R1902:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R2135:Ptchd4 UTSW 17 42317074 missense probably benign 0.01
R3935:Ptchd4 UTSW 17 42503489 missense possibly damaging 0.80
R4184:Ptchd4 UTSW 17 42502759 missense probably damaging 0.99
R4552:Ptchd4 UTSW 17 42502455 missense probably benign 0.00
R4573:Ptchd4 UTSW 17 42502777 missense probably benign 0.26
R5100:Ptchd4 UTSW 17 42503676 missense possibly damaging 0.59
R5640:Ptchd4 UTSW 17 42503135 missense possibly damaging 0.73
R6213:Ptchd4 UTSW 17 42377360 missense probably benign 0.00
R6704:Ptchd4 UTSW 17 42317040 missense probably benign 0.00
R7011:Ptchd4 UTSW 17 42503868 missense probably benign 0.19
R7017:Ptchd4 UTSW 17 42502735 missense probably damaging 1.00
R8112:Ptchd4 UTSW 17 42503175 missense probably benign 0.25
R8153:Ptchd4 UTSW 17 42503896 missense probably benign 0.31
R8220:Ptchd4 UTSW 17 42502663 missense probably benign 0.00
X0062:Ptchd4 UTSW 17 42377464 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAACAGCAGTGTCCAAG -3'
(R):5'- AAGCCTGCGATCAGAACAGG -3'

Sequencing Primer
(F):5'- CCAAGAGGATCTGCAGAGGCTC -3'
(R):5'- GCACAGTGACTGACAAACTG -3'
Posted On2019-06-26