Incidental Mutation 'R7186:Usp50'
ID559277
Institutional Source Beutler Lab
Gene Symbol Usp50
Ensembl Gene ENSMUSG00000027364
Gene Nameubiquitin specific peptidase 50
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7186 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126709096-126783470 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 126783298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028842] [ENSMUST00000130356] [ENSMUST00000136319]
Predicted Effect probably benign
Transcript: ENSMUST00000028842
SMART Domains Protein: ENSMUSP00000028842
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 44 360 9.2e-67 PFAM
Pfam:UCH_1 45 342 2.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130356
SMART Domains Protein: ENSMUSP00000116873
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 8 183 1.5e-20 PFAM
Pfam:UCH_1 22 194 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,019,273 I778F possibly damaging Het
Adam39 A T 8: 40,826,312 N580I probably damaging Het
Adamts20 A G 15: 94,322,808 S1415P possibly damaging Het
Adcy2 A G 13: 68,668,639 Y743H probably damaging Het
Aldh1a3 A G 7: 66,406,083 V320A probably damaging Het
Arid1a TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG 4: 133,753,233 Het
Art5 G T 7: 102,097,329 R268S probably benign Het
Bfar T C 16: 13,692,507 V238A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc23 G A 18: 34,637,122 T408I probably damaging Het
Cdh24 G C 14: 54,633,492 P522A probably benign Het
Clk4 T C 11: 51,268,780 V61A probably benign Het
Clrn2 T C 5: 45,453,773 probably benign Het
Cyp2j8 T C 4: 96,475,550 D292G probably benign Het
Deaf1 T C 7: 141,327,470 E34G probably benign Het
Elovl7 A G 13: 108,271,848 E127G probably damaging Het
Fam46b T A 4: 133,486,207 F130I probably damaging Het
Flg A T 3: 93,279,945 R235* probably null Het
Gbp3 G A 3: 142,564,162 V77M probably damaging Het
Gda A T 19: 21,395,205 F450I probably benign Het
Gipc1 A G 8: 83,664,133 E289G possibly damaging Het
Gm21731 C T 13: 120,241,051 L128F probably damaging Het
Gm4924 T C 10: 82,378,944 Y859H unknown Het
Gpatch1 A T 7: 35,295,313 D509E possibly damaging Het
Gpbp1 A G 13: 111,440,699 V219A possibly damaging Het
Gpr107 A T 2: 31,152,359 M1L possibly damaging Het
Heg1 T C 16: 33,731,664 F1003L probably damaging Het
Hivep1 A G 13: 42,156,338 T685A probably benign Het
Hpse T A 5: 100,695,529 D259V probably damaging Het
Ido2 A T 8: 24,550,810 probably null Het
Ighv14-1 T C 12: 113,932,029 D92G probably damaging Het
Krt83 A T 15: 101,487,202 probably null Het
Lsp1 T C 7: 142,490,352 V278A probably damaging Het
Lurap1l C A 4: 80,911,510 S52R possibly damaging Het
Luzp2 A G 7: 54,835,829 probably benign Het
Micall1 A G 15: 79,125,375 E399G unknown Het
Ncapd2 A G 6: 125,186,156 S130P possibly damaging Het
Nrg2 A G 18: 36,045,920 V321A probably benign Het
Nuf2 T C 1: 169,525,385 H17R probably damaging Het
Numb A G 12: 83,796,146 W419R probably damaging Het
Olfr1318 T A 2: 112,156,162 D70E probably damaging Het
Olfr462 G A 11: 87,889,765 L44F possibly damaging Het
Olfr681 A G 7: 105,122,266 R270G probably benign Het
Pde6a T A 18: 61,220,606 M1K probably null Het
Pknox1 C T 17: 31,603,198 A313V probably damaging Het
Ppp2ca T A 11: 52,119,253 N229K possibly damaging Het
Ptgdr A T 14: 44,858,944 C104S probably damaging Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rfx5 G T 3: 94,958,348 K319N probably benign Het
Rnase10 A T 14: 51,009,785 T207S probably damaging Het
Rreb1 A G 13: 37,941,632 T1305A probably benign Het
Rrp12 C A 19: 41,871,305 probably null Het
Rubcnl A C 14: 75,032,013 D37A possibly damaging Het
Scn9a T C 2: 66,534,223 Y802C probably damaging Het
Sec16a A T 2: 26,440,703 Y433* probably null Het
Sgk3 T A 1: 9,886,002 V331D probably benign Het
Sirt7 C T 11: 120,620,485 R280H probably benign Het
Snx13 G C 12: 35,092,913 R252S probably damaging Het
Stk32b G T 5: 37,466,781 D207E probably damaging Het
Sult2a7 C T 7: 14,470,053 V262I not run Het
Tex45 T C 8: 3,479,049 F208S probably damaging Het
Tmem33 G C 5: 67,263,787 V35L possibly damaging Het
Uba1y A G Y: 825,537 I300V probably benign Het
Usp32 A T 11: 85,051,234 V344E probably benign Het
Vmn1r238 A C 18: 3,122,661 F251C probably damaging Het
Vmn2r74 A T 7: 85,951,942 Y829* probably null Het
Wars A G 12: 108,881,056 F141L probably damaging Het
Zfp879 A G 11: 50,833,794 V145A probably benign Het
Zfp934 A T 13: 62,492,390 V56D probably benign Het
Other mutations in Usp50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Usp50 APN 2 126709414 missense probably damaging 0.98
IGL01565:Usp50 APN 2 126777968 nonsense probably null
IGL01976:Usp50 APN 2 126709466 missense probably benign 0.10
IGL02192:Usp50 APN 2 126778038 missense possibly damaging 0.94
IGL02272:Usp50 APN 2 126769944 missense probably damaging 0.98
IGL02892:Usp50 APN 2 126769902 missense probably damaging 1.00
PIT4453001:Usp50 UTSW 2 126783316 start gained probably benign
R0034:Usp50 UTSW 2 126777975 missense possibly damaging 0.89
R0382:Usp50 UTSW 2 126777928 missense probably damaging 1.00
R0433:Usp50 UTSW 2 126761544 missense probably damaging 0.98
R1146:Usp50 UTSW 2 126709472 missense probably benign 0.02
R1457:Usp50 UTSW 2 126761634 missense probably benign 0.41
R1475:Usp50 UTSW 2 126769867 splice site probably null
R1758:Usp50 UTSW 2 126775862 missense probably damaging 1.00
R1889:Usp50 UTSW 2 126777898 critical splice donor site probably null
R1940:Usp50 UTSW 2 126778023 missense probably benign 0.03
R1959:Usp50 UTSW 2 126777961 missense possibly damaging 0.91
R2698:Usp50 UTSW 2 126778029 missense probably damaging 0.97
R4648:Usp50 UTSW 2 126778033 missense probably damaging 0.98
R4809:Usp50 UTSW 2 126777853 intron probably benign
R6247:Usp50 UTSW 2 126775793 missense probably benign 0.33
R7030:Usp50 UTSW 2 126780475 missense possibly damaging 0.78
R7522:Usp50 UTSW 2 126783226 missense probably damaging 1.00
X0064:Usp50 UTSW 2 126761646 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCATGGGTCAAATCTGGC -3'
(R):5'- GAACCTTGGTATGAAGGGTGAC -3'

Sequencing Primer
(F):5'- CATGGGTCAAATCTGGCAGAGC -3'
(R):5'- ACCTTGGTATGAAGGGTGACAATTG -3'
Posted On2019-06-26