Mutagenetix > Incidental Mutations

Incidental Mutation 'R7186:Arid1a'

559285

Institutional Source

Beutler Lab

Gene Symbol

Arid1a

Ensembl Gene

ENSMUSG00000007880

Gene Name

AT rich interactive domain 1A (SWI-like)

Synonyms

1110030E03Rik, Smarcf1, BAF250a, Osa1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7186 (G1)

Quality Score

107.467

Status

Not validated

Chromosome

Chromosomal Location

133679008-133756769 bp(-) (GRCm38)

Type of Mutation

DNA Base Change (assembly)

TGCCGCCGCCGCCGCCGCCGCCG to TGCCGCCGCCGCCGCCGCCG at 133753233 bp

Zygosity

Heterozygous

Amino Acid Change

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	T	A	11: 49,019,273	I778F	possibly damaging	Het
Adam39	A	T	8: 40,826,312	N580I	probably damaging	Het
Adamts20	A	G	15: 94,322,808	S1415P	possibly damaging	Het
Adcy2	A	G	13: 68,668,639	Y743H	probably damaging	Het
Aldh1a3	A	G	7: 66,406,083	V320A	probably damaging	Het
Art5	G	T	7: 102,097,329	R268S	probably benign	Het
Bfar	T	C	16: 13,692,507	V238A	probably benign	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Cdc23	G	A	18: 34,637,122	T408I	probably damaging	Het
Cdh24	G	C	14: 54,633,492	P522A	probably benign	Het
Clk4	T	C	11: 51,268,780	V61A	probably benign	Het
Clrn2	T	C	5: 45,453,773		probably benign	Het
Cyp2j8	T	C	4: 96,475,550	D292G	probably benign	Het
Deaf1	T	C	7: 141,327,470	E34G	probably benign	Het
Elovl7	A	G	13: 108,271,848	E127G	probably damaging	Het
Fam46b	T	A	4: 133,486,207	F130I	probably damaging	Het
Flg	A	T	3: 93,279,945	R235*	probably null	Het
Gbp3	G	A	3: 142,564,162	V77M	probably damaging	Het
Gda	A	T	19: 21,395,205	F450I	probably benign	Het
Gipc1	A	G	8: 83,664,133	E289G	possibly damaging	Het
Gm21731	C	T	13: 120,241,051	L128F	probably damaging	Het
Gm4924	T	C	10: 82,378,944	Y859H	unknown	Het
Gpatch1	A	T	7: 35,295,313	D509E	possibly damaging	Het
Gpbp1	A	G	13: 111,440,699	V219A	possibly damaging	Het
Gpr107	A	T	2: 31,152,359	M1L	possibly damaging	Het
Heg1	T	C	16: 33,731,664	F1003L	probably damaging	Het
Hivep1	A	G	13: 42,156,338	T685A	probably benign	Het
Hpse	T	A	5: 100,695,529	D259V	probably damaging	Het
Ido2	A	T	8: 24,550,810		probably null	Het
Ighv14-1	T	C	12: 113,932,029	D92G	probably damaging	Het
Krt83	A	T	15: 101,487,202		probably null	Het
Lsp1	T	C	7: 142,490,352	V278A	probably damaging	Het
Lurap1l	C	A	4: 80,911,510	S52R	possibly damaging	Het
Luzp2	A	G	7: 54,835,829		probably benign	Het
Micall1	A	G	15: 79,125,375	E399G	unknown	Het
Ncapd2	A	G	6: 125,186,156	S130P	possibly damaging	Het
Nrg2	A	G	18: 36,045,920	V321A	probably benign	Het
Nuf2	T	C	1: 169,525,385	H17R	probably damaging	Het
Numb	A	G	12: 83,796,146	W419R	probably damaging	Het
Olfr1318	T	A	2: 112,156,162	D70E	probably damaging	Het
Olfr462	G	A	11: 87,889,765	L44F	possibly damaging	Het
Olfr681	A	G	7: 105,122,266	R270G	probably benign	Het
Pde6a	T	A	18: 61,220,606	M1K	probably null	Het
Pknox1	C	T	17: 31,603,198	A313V	probably damaging	Het
Ppp2ca	T	A	11: 52,119,253	N229K	possibly damaging	Het
Ptgdr	A	T	14: 44,858,944	C104S	probably damaging	Het
Ralgapa2	C	A	2: 146,388,486		probably null	Het
Rfx5	G	T	3: 94,958,348	K319N	probably benign	Het
Rnase10	A	T	14: 51,009,785	T207S	probably damaging	Het
Rreb1	A	G	13: 37,941,632	T1305A	probably benign	Het
Rrp12	C	A	19: 41,871,305		probably null	Het
Rubcnl	A	C	14: 75,032,013	D37A	possibly damaging	Het
Scn9a	T	C	2: 66,534,223	Y802C	probably damaging	Het
Sec16a	A	T	2: 26,440,703	Y433*	probably null	Het
Sgk3	T	A	1: 9,886,002	V331D	probably benign	Het
Sirt7	C	T	11: 120,620,485	R280H	probably benign	Het
Snx13	G	C	12: 35,092,913	R252S	probably damaging	Het
Stk32b	G	T	5: 37,466,781	D207E	probably damaging	Het
Sult2a7	C	T	7: 14,470,053	V262I	not run	Het
Tex45	T	C	8: 3,479,049	F208S	probably damaging	Het
Tmem33	G	C	5: 67,263,787	V35L	possibly damaging	Het
Uba1y	A	G	Y: 825,537	I300V	probably benign	Het
Usp32	A	T	11: 85,051,234	V344E	probably benign	Het
Usp50	C	T	2: 126,783,298		probably benign	Het
Vmn1r238	A	C	18: 3,122,661	F251C	probably damaging	Het
Vmn2r74	A	T	7: 85,951,942	Y829*	probably null	Het
Wars	A	G	12: 108,881,056	F141L	probably damaging	Het
Zfp879	A	G	11: 50,833,794	V145A	probably benign	Het
Zfp934	A	T	13: 62,492,390	V56D	probably benign	Het

Other mutations in Arid1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Arid1a	APN	4	133685482	missense	unknown
IGL01139:Arid1a	APN	4	133693997	missense	unknown
IGL01392:Arid1a	APN	4	133681037	missense	unknown
IGL01543:Arid1a	APN	4	133681722	missense	unknown
IGL01642:Arid1a	APN	4	133681844	missense	unknown
IGL01843:Arid1a	APN	4	133681454	missense	unknown
IGL02108:Arid1a	APN	4	133680516	missense	unknown
IGL02117:Arid1a	APN	4	133692815	missense	unknown
IGL02150:Arid1a	APN	4	133687257	missense	unknown
IGL02478:Arid1a	APN	4	133681274	missense	unknown
IGL02544:Arid1a	APN	4	133681748	missense	unknown
IGL03070:Arid1a	APN	4	133694753	missense	unknown
PIT4520001:Arid1a	UTSW	4	133681916	missense	unknown
R0023:Arid1a	UTSW	4	133691176	missense	unknown
R0023:Arid1a	UTSW	4	133691176	missense	unknown
R0419:Arid1a	UTSW	4	133681124	missense	unknown
R0452:Arid1a	UTSW	4	133689105	missense	unknown
R0631:Arid1a	UTSW	4	133689170	missense	unknown
R0648:Arid1a	UTSW	4	133685204	missense	unknown
R1004:Arid1a	UTSW	4	133687275	missense	unknown
R1225:Arid1a	UTSW	4	133687365	missense	unknown
R1229:Arid1a	UTSW	4	133691237	missense	unknown
R1435:Arid1a	UTSW	4	133680698	missense	unknown
R1480:Arid1a	UTSW	4	133680389	missense	unknown
R1491:Arid1a	UTSW	4	133720926	missense	unknown
R1674:Arid1a	UTSW	4	133689260	missense	unknown
R1909:Arid1a	UTSW	4	133693761	missense	unknown
R1960:Arid1a	UTSW	4	133753090	missense	possibly damaging	0.84
R2018:Arid1a	UTSW	4	133681834	missense	unknown
R2147:Arid1a	UTSW	4	133681366	missense	unknown
R2303:Arid1a	UTSW	4	133687251	missense	unknown
R2320:Arid1a	UTSW	4	133680529	missense	unknown
R3775:Arid1a	UTSW	4	133686764	missense	unknown
R3907:Arid1a	UTSW	4	133692912	splice site	probably benign
R4509:Arid1a	UTSW	4	133695699	intron	probably benign
R4510:Arid1a	UTSW	4	133695699	intron	probably benign
R4551:Arid1a	UTSW	4	133695699	intron	probably benign
R4552:Arid1a	UTSW	4	133695699	intron	probably benign
R4606:Arid1a	UTSW	4	133687323	missense	unknown
R4745:Arid1a	UTSW	4	133753106	missense	probably benign	0.33
R4851:Arid1a	UTSW	4	133681361	missense	unknown
R4867:Arid1a	UTSW	4	133720857	missense	probably benign	0.01
R5203:Arid1a	UTSW	4	133682003	missense	unknown
R5227:Arid1a	UTSW	4	133680405	missense	unknown
R5294:Arid1a	UTSW	4	133691055	splice site	probably benign
R5299:Arid1a	UTSW	4	133687226	missense	unknown
R5412:Arid1a	UTSW	4	133719602	unclassified	probably benign
R5540:Arid1a	UTSW	4	133680454	missense	unknown
R5704:Arid1a	UTSW	4	133681739	missense	unknown
R5870:Arid1a	UTSW	4	133681076	missense	unknown
R6092:Arid1a	UTSW	4	133693852	missense	unknown
R6151:Arid1a	UTSW	4	133684976	missense	unknown
R6240:Arid1a	UTSW	4	133680686	missense	unknown
R6379:Arid1a	UTSW	4	133680927	missense	unknown
R6427:Arid1a	UTSW	4	133681524	missense	unknown
R6739:Arid1a	UTSW	4	133687626	missense	unknown
R7159:Arid1a	UTSW	4	133753568	missense	unknown
R7354:Arid1a	UTSW	4	133693947	missense	unknown
R7408:Arid1a	UTSW	4	133681080	missense	unknown
R7452:Arid1a	UTSW	4	133753127	missense	possibly damaging	0.86
R7471:Arid1a	UTSW	4	133681044	missense	unknown
R7478:Arid1a	UTSW	4	133685171	missense	unknown
R7581:Arid1a	UTSW	4	133680351	missense	unknown
R7614:Arid1a	UTSW	4	133691155	missense	unknown
R7712:Arid1a	UTSW	4	133752611	missense	probably benign	0.14
R7734:Arid1a	UTSW	4	133681368	missense	unknown
R7878:Arid1a	UTSW	4	133687271	missense	unknown
R7973:Arid1a	UTSW	4	133753070	missense	probably damaging	0.96
R8012:Arid1a	UTSW	4	133692863	missense	unknown
R8355:Arid1a	UTSW	4	133720863	missense	unknown
R8396:Arid1a	UTSW	4	133752662	missense	probably damaging	0.99
RF012:Arid1a	UTSW	4	133752820	small deletion	probably benign
RF015:Arid1a	UTSW	4	133752831	small deletion	probably benign
X0064:Arid1a	UTSW	4	133689260	missense	unknown
Z1176:Arid1a	UTSW	4	133720550	missense	probably null
Z1177:Arid1a	UTSW	4	133680916	missense	unknown

Predicted Primers

Posted On

2019-06-26