Incidental Mutation 'R0590:Ifngr1'
ID 55930
Institutional Source Beutler Lab
Gene Symbol Ifngr1
Ensembl Gene ENSMUSG00000020009
Gene Name interferon gamma receptor 1
Synonyms CD119, Ifgr, IFN-gamma R, Nktar, Ifngr, IFN-gammaR
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0590 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 19591949-19610229 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 19603942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]
AlphaFold P15261
Predicted Effect probably benign
Transcript: ENSMUST00000020188
SMART Domains Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 119 2.2e-27 PFAM
Pfam:Interfer-bind 131 245 8.5e-9 PFAM
Pfam:IFNGR1 168 331 1.6e-53 PFAM
low complexity region 401 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164591
SMART Domains Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 74 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171772
SMART Domains Protein: ENSMUSP00000127219
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 94 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172253
SMART Domains Protein: ENSMUSP00000127484
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Ifngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ifngr1 APN 10 19609198 missense probably damaging 0.99
IGL01125:Ifngr1 APN 10 19597413 splice site probably benign
IGL01366:Ifngr1 APN 10 19609600 missense probably damaging 1.00
IGL01951:Ifngr1 APN 10 19609454 missense possibly damaging 0.94
IGL02037:Ifngr1 APN 10 19607259 missense probably benign 0.26
Marigold UTSW 10 19601485 critical splice donor site probably null
BB007:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
BB017:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
R0023:Ifngr1 UTSW 10 19609449 nonsense probably null
R0325:Ifngr1 UTSW 10 19597432 missense probably damaging 1.00
R1305:Ifngr1 UTSW 10 19606253 missense possibly damaging 0.91
R1496:Ifngr1 UTSW 10 19601445 missense probably benign 0.04
R1597:Ifngr1 UTSW 10 19609342 missense probably damaging 0.99
R2019:Ifngr1 UTSW 10 19592113 missense probably damaging 0.99
R2302:Ifngr1 UTSW 10 19609645 missense probably damaging 1.00
R2484:Ifngr1 UTSW 10 19601415 missense probably damaging 1.00
R4089:Ifngr1 UTSW 10 19601485 critical splice donor site probably null
R4464:Ifngr1 UTSW 10 19597517 missense possibly damaging 0.75
R4863:Ifngr1 UTSW 10 19609416 missense probably damaging 1.00
R6045:Ifngr1 UTSW 10 19609161 missense possibly damaging 0.61
R6047:Ifngr1 UTSW 10 19606313 missense probably damaging 1.00
R6089:Ifngr1 UTSW 10 19606300 missense probably benign 0.01
R6750:Ifngr1 UTSW 10 19609351 missense probably benign 0.06
R6950:Ifngr1 UTSW 10 19607293 missense probably damaging 0.99
R7162:Ifngr1 UTSW 10 19609353 missense probably benign
R7930:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
R8178:Ifngr1 UTSW 10 19609493 missense probably benign 0.03
R8436:Ifngr1 UTSW 10 19603805 missense probably damaging 1.00
R8975:Ifngr1 UTSW 10 19609612 missense probably damaging 1.00
R9451:Ifngr1 UTSW 10 19607293 missense possibly damaging 0.61
T0975:Ifngr1 UTSW 10 19609473 missense probably damaging 0.98
X0005:Ifngr1 UTSW 10 19609473 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGAAGAACAGCTCTCCGTCCTC -3'
(R):5'- CGTGGCACTGTAGATGTACTGTCAG -3'

Sequencing Primer
(F):5'- CGTATTTCACCCTGAAGTCGTTG -3'
(R):5'- CACTGTAGATGTACTGTCAGCTTATC -3'
Posted On 2013-07-11