Mutagenetix > Incidental Mutations

Incidental Mutation 'R0590:Ifngr1'

55930

Institutional Source

Beutler Lab

Gene Symbol

Ifngr1

Ensembl Gene

ENSMUSG00000020009

Gene Name

interferon gamma receptor 1

Synonyms

CD119, Ifgr, IFN-gamma R, Nktar, Ifngr, IFN-gammaR

MMRRC Submission

038780-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0590 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19591949-19610229 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 19603942 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]

Predicted Effect

probably benign
Transcript: ENSMUST00000020188

SMART Domains

Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	119	2.2e-27	PFAM
Pfam:Interfer-bind	131	245	8.5e-9	PFAM
Pfam:IFNGR1	168	331	1.6e-53	PFAM
low complexity region	401	416	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164591

SMART Domains

Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	74	2.3e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168074

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171772

SMART Domains

Protein: ENSMUSP00000127219
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	94	1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172253

SMART Domains

Protein: ENSMUSP00000127484
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
transmembrane domain	42	64	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gls	G	A	1: 52,212,375		probably benign	Het
Gria1	A	T	11: 57,289,409	Q728H	probably damaging	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ipo5	T	C	14: 120,944,357	V954A	possibly damaging	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Kif14	T	C	1: 136,482,472	S646P	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nr1h4	A	G	10: 89,456,567	Y398H	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zc3h7b	C	T	15: 81,776,998	T346M	possibly damaging	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Ifngr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ifngr1	APN	10	19609198	missense	probably damaging	0.99
IGL01125:Ifngr1	APN	10	19597413	splice site	probably benign
IGL01366:Ifngr1	APN	10	19609600	missense	probably damaging	1.00
IGL01951:Ifngr1	APN	10	19609454	missense	possibly damaging	0.94
IGL02037:Ifngr1	APN	10	19607259	missense	probably benign	0.26
marigold	UTSW	10	19601485	critical splice donor site	probably null
R0023:Ifngr1	UTSW	10	19609449	nonsense	probably null
R0325:Ifngr1	UTSW	10	19597432	missense	probably damaging	1.00
R1305:Ifngr1	UTSW	10	19606253	missense	possibly damaging	0.91
R1496:Ifngr1	UTSW	10	19601445	missense	probably benign	0.04
R1597:Ifngr1	UTSW	10	19609342	missense	probably damaging	0.99
R2019:Ifngr1	UTSW	10	19592113	missense	probably damaging	0.99
R2302:Ifngr1	UTSW	10	19609645	missense	probably damaging	1.00
R2484:Ifngr1	UTSW	10	19601415	missense	probably damaging	1.00
R4089:Ifngr1	UTSW	10	19601485	critical splice donor site	probably null
R4464:Ifngr1	UTSW	10	19597517	missense	possibly damaging	0.75
R4863:Ifngr1	UTSW	10	19609416	missense	probably damaging	1.00
R6045:Ifngr1	UTSW	10	19609161	missense	possibly damaging	0.61
R6047:Ifngr1	UTSW	10	19606313	missense	probably damaging	1.00
R6089:Ifngr1	UTSW	10	19606300	missense	probably benign	0.01
R6750:Ifngr1	UTSW	10	19609351	missense	probably benign	0.06
R6950:Ifngr1	UTSW	10	19607293	missense	probably damaging	0.99
R7162:Ifngr1	UTSW	10	19609353	missense	probably benign
T0975:Ifngr1	UTSW	10	19609473	missense	probably damaging	0.98
X0005:Ifngr1	UTSW	10	19609473	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGGAAGAACAGCTCTCCGTCCTC -3'
(R):5'- CGTGGCACTGTAGATGTACTGTCAG -3'

Sequencing Primer
(F):5'- CGTATTTCACCCTGAAGTCGTTG -3'
(R):5'- CACTGTAGATGTACTGTCAGCTTATC -3'

Posted On

2013-07-11