Incidental Mutation 'R7186:Usp32'
ID 559307
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7186 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85051234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 344 (V344E)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000108075
AA Change: V344E

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: V344E

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Meta Mutation Damage Score 0.5037 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,019,273 I778F possibly damaging Het
Adam39 A T 8: 40,826,312 N580I probably damaging Het
Adamts20 A G 15: 94,322,808 S1415P possibly damaging Het
Adcy2 A G 13: 68,668,639 Y743H probably damaging Het
Aldh1a3 A G 7: 66,406,083 V320A probably damaging Het
Arid1a TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG 4: 133,753,233 Het
Art5 G T 7: 102,097,329 R268S probably benign Het
Bfar T C 16: 13,692,507 V238A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc23 G A 18: 34,637,122 T408I probably damaging Het
Cdh24 G C 14: 54,633,492 P522A probably benign Het
Clk4 T C 11: 51,268,780 V61A probably benign Het
Clrn2 T C 5: 45,453,773 probably benign Het
Cyp2j8 T C 4: 96,475,550 D292G probably benign Het
Deaf1 T C 7: 141,327,470 E34G probably benign Het
Elovl7 A G 13: 108,271,848 E127G probably damaging Het
Fam46b T A 4: 133,486,207 F130I probably damaging Het
Flg A T 3: 93,279,945 R235* probably null Het
Gbp3 G A 3: 142,564,162 V77M probably damaging Het
Gda A T 19: 21,395,205 F450I probably benign Het
Gipc1 A G 8: 83,664,133 E289G possibly damaging Het
Gm21731 C T 13: 120,241,051 L128F probably damaging Het
Gm4924 T C 10: 82,378,944 Y859H unknown Het
Gpatch1 A T 7: 35,295,313 D509E possibly damaging Het
Gpbp1 A G 13: 111,440,699 V219A possibly damaging Het
Gpr107 A T 2: 31,152,359 M1L possibly damaging Het
Heg1 T C 16: 33,731,664 F1003L probably damaging Het
Hivep1 A G 13: 42,156,338 T685A probably benign Het
Hpse T A 5: 100,695,529 D259V probably damaging Het
Ido2 A T 8: 24,550,810 probably null Het
Ighv14-1 T C 12: 113,932,029 D92G probably damaging Het
Krt83 A T 15: 101,487,202 probably null Het
Lsp1 T C 7: 142,490,352 V278A probably damaging Het
Lurap1l C A 4: 80,911,510 S52R possibly damaging Het
Luzp2 A G 7: 54,835,829 probably benign Het
Micall1 A G 15: 79,125,375 E399G unknown Het
Ncapd2 A G 6: 125,186,156 S130P possibly damaging Het
Nrg2 A G 18: 36,045,920 V321A probably benign Het
Nuf2 T C 1: 169,525,385 H17R probably damaging Het
Numb A G 12: 83,796,146 W419R probably damaging Het
Olfr1318 T A 2: 112,156,162 D70E probably damaging Het
Olfr462 G A 11: 87,889,765 L44F possibly damaging Het
Olfr681 A G 7: 105,122,266 R270G probably benign Het
Pde6a T A 18: 61,220,606 M1K probably null Het
Pknox1 C T 17: 31,603,198 A313V probably damaging Het
Ppp2ca T A 11: 52,119,253 N229K possibly damaging Het
Ptgdr A T 14: 44,858,944 C104S probably damaging Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rfx5 G T 3: 94,958,348 K319N probably benign Het
Rnase10 A T 14: 51,009,785 T207S probably damaging Het
Rreb1 A G 13: 37,941,632 T1305A probably benign Het
Rrp12 C A 19: 41,871,305 probably null Het
Rubcnl A C 14: 75,032,013 D37A possibly damaging Het
Scn9a T C 2: 66,534,223 Y802C probably damaging Het
Sec16a A T 2: 26,440,703 Y433* probably null Het
Sgk3 T A 1: 9,886,002 V331D probably benign Het
Sirt7 C T 11: 120,620,485 R280H probably benign Het
Snx13 G C 12: 35,092,913 R252S probably damaging Het
Stk32b G T 5: 37,466,781 D207E probably damaging Het
Sult2a7 C T 7: 14,470,053 V262I not run Het
Tex45 T C 8: 3,479,049 F208S probably damaging Het
Tmem33 G C 5: 67,263,787 V35L possibly damaging Het
Uba1y A G Y: 825,537 I300V probably benign Het
Usp50 C T 2: 126,783,298 probably benign Het
Vmn1r238 A C 18: 3,122,661 F251C probably damaging Het
Vmn2r74 A T 7: 85,951,942 Y829* probably null Het
Wars A G 12: 108,881,056 F141L probably damaging Het
Zfp879 A G 11: 50,833,794 V145A probably benign Het
Zfp934 A T 13: 62,492,390 V56D probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGTCAAGAAGAGACCAATTTCC -3'
(R):5'- AAGCTTCATTTTCACTGGCTAC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TCACTTGTAAGCTCATACTAATTGTG -3'
Posted On 2019-06-26