Incidental Mutation 'R7186:Numb'
ID559311
Institutional Source Beutler Lab
Gene Symbol Numb
Ensembl Gene ENSMUSG00000021224
Gene NameNUMB endocytic adaptor protein
Synonymsm-numb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7186 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83794034-83921934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83796146 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 419 (W419R)
Ref Sequence ENSEMBL: ENSMUSP00000119303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000021647] [ENSMUST00000085215] [ENSMUST00000110298] [ENSMUST00000117217] [ENSMUST00000121733] [ENSMUST00000129335] [ENSMUST00000154043]
Predicted Effect probably benign
Transcript: ENSMUST00000021646
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021647
AA Change: W370R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021647
Gene: ENSMUSG00000021224
AA Change: W370R

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 339 4.7e-42 PFAM
low complexity region 413 434 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085215
SMART Domains Protein: ENSMUSP00000082311
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 322 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110298
SMART Domains Protein: ENSMUSP00000105927
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PID 39 76 2.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117217
AA Change: W359R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113591
Gene: ENSMUSG00000021224
AA Change: W359R

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 4.5e-42 PFAM
low complexity region 402 423 N/A INTRINSIC
low complexity region 434 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121733
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129335
AA Change: W419R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119303
Gene: ENSMUSG00000021224
AA Change: W419R

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 258 338 9.9e-32 PFAM
low complexity region 462 483 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154043
AA Change: W408R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117899
Gene: ENSMUSG00000021224
AA Change: W408R

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 5.1e-42 PFAM
low complexity region 451 472 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a conserved protein that is distributed asymmetrically during cell division in the developing embryo. The encoded protein participates in cell fate decisions by interacting with the Notch receptor. Loss of function of this gene results in severe defects in neural development and loss of viability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele die at ~E11.5 with neural tube closure defects and precocious cortical neurogenesis. Mice homozygous for another null allele show impaired axial rotation, neural tube closure, angiogenic remodeling, placenta formation, and motor and sensory neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,019,273 I778F possibly damaging Het
Adam39 A T 8: 40,826,312 N580I probably damaging Het
Adamts20 A G 15: 94,322,808 S1415P possibly damaging Het
Adcy2 A G 13: 68,668,639 Y743H probably damaging Het
Aldh1a3 A G 7: 66,406,083 V320A probably damaging Het
Arid1a TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG 4: 133,753,233 Het
Art5 G T 7: 102,097,329 R268S probably benign Het
Bfar T C 16: 13,692,507 V238A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc23 G A 18: 34,637,122 T408I probably damaging Het
Cdh24 G C 14: 54,633,492 P522A probably benign Het
Clk4 T C 11: 51,268,780 V61A probably benign Het
Clrn2 T C 5: 45,453,773 probably benign Het
Cyp2j8 T C 4: 96,475,550 D292G probably benign Het
Deaf1 T C 7: 141,327,470 E34G probably benign Het
Elovl7 A G 13: 108,271,848 E127G probably damaging Het
Fam46b T A 4: 133,486,207 F130I probably damaging Het
Flg A T 3: 93,279,945 R235* probably null Het
Gbp3 G A 3: 142,564,162 V77M probably damaging Het
Gda A T 19: 21,395,205 F450I probably benign Het
Gipc1 A G 8: 83,664,133 E289G possibly damaging Het
Gm21731 C T 13: 120,241,051 L128F probably damaging Het
Gm4924 T C 10: 82,378,944 Y859H unknown Het
Gpatch1 A T 7: 35,295,313 D509E possibly damaging Het
Gpbp1 A G 13: 111,440,699 V219A possibly damaging Het
Gpr107 A T 2: 31,152,359 M1L possibly damaging Het
Heg1 T C 16: 33,731,664 F1003L probably damaging Het
Hivep1 A G 13: 42,156,338 T685A probably benign Het
Hpse T A 5: 100,695,529 D259V probably damaging Het
Ido2 A T 8: 24,550,810 probably null Het
Ighv14-1 T C 12: 113,932,029 D92G probably damaging Het
Krt83 A T 15: 101,487,202 probably null Het
Lsp1 T C 7: 142,490,352 V278A probably damaging Het
Lurap1l C A 4: 80,911,510 S52R possibly damaging Het
Luzp2 A G 7: 54,835,829 probably benign Het
Micall1 A G 15: 79,125,375 E399G unknown Het
Ncapd2 A G 6: 125,186,156 S130P possibly damaging Het
Nrg2 A G 18: 36,045,920 V321A probably benign Het
Nuf2 T C 1: 169,525,385 H17R probably damaging Het
Olfr1318 T A 2: 112,156,162 D70E probably damaging Het
Olfr462 G A 11: 87,889,765 L44F possibly damaging Het
Olfr681 A G 7: 105,122,266 R270G probably benign Het
Pde6a T A 18: 61,220,606 M1K probably null Het
Pknox1 C T 17: 31,603,198 A313V probably damaging Het
Ppp2ca T A 11: 52,119,253 N229K possibly damaging Het
Ptgdr A T 14: 44,858,944 C104S probably damaging Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rfx5 G T 3: 94,958,348 K319N probably benign Het
Rnase10 A T 14: 51,009,785 T207S probably damaging Het
Rreb1 A G 13: 37,941,632 T1305A probably benign Het
Rrp12 C A 19: 41,871,305 probably null Het
Rubcnl A C 14: 75,032,013 D37A possibly damaging Het
Scn9a T C 2: 66,534,223 Y802C probably damaging Het
Sec16a A T 2: 26,440,703 Y433* probably null Het
Sgk3 T A 1: 9,886,002 V331D probably benign Het
Sirt7 C T 11: 120,620,485 R280H probably benign Het
Snx13 G C 12: 35,092,913 R252S probably damaging Het
Stk32b G T 5: 37,466,781 D207E probably damaging Het
Sult2a7 C T 7: 14,470,053 V262I not run Het
Tex45 T C 8: 3,479,049 F208S probably damaging Het
Tmem33 G C 5: 67,263,787 V35L possibly damaging Het
Uba1y A G Y: 825,537 I300V probably benign Het
Usp32 A T 11: 85,051,234 V344E probably benign Het
Usp50 C T 2: 126,783,298 probably benign Het
Vmn1r238 A C 18: 3,122,661 F251C probably damaging Het
Vmn2r74 A T 7: 85,951,942 Y829* probably null Het
Wars A G 12: 108,881,056 F141L probably damaging Het
Zfp879 A G 11: 50,833,794 V145A probably benign Het
Zfp934 A T 13: 62,492,390 V56D probably benign Het
Other mutations in Numb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Numb APN 12 83808132 missense probably damaging 1.00
IGL01979:Numb APN 12 83842277 missense probably damaging 1.00
IGL02318:Numb APN 12 83831918 splice site probably null
IGL02716:Numb APN 12 83801208 missense possibly damaging 0.79
IGL03206:Numb APN 12 83825296 splice site probably benign
PIT4468001:Numb UTSW 12 83808147 missense probably damaging 0.99
R0086:Numb UTSW 12 83795930 missense probably damaging 1.00
R0626:Numb UTSW 12 83795840 missense probably damaging 0.97
R0652:Numb UTSW 12 83795792 missense probably damaging 1.00
R1201:Numb UTSW 12 83801285 missense probably damaging 0.99
R1295:Numb UTSW 12 83796161 splice site probably benign
R1433:Numb UTSW 12 83797259 missense probably damaging 0.98
R1489:Numb UTSW 12 83795443 missense probably damaging 1.00
R1606:Numb UTSW 12 83801010 splice site probably null
R1980:Numb UTSW 12 83797344 critical splice acceptor site probably null
R3771:Numb UTSW 12 83799576 missense probably damaging 0.99
R5382:Numb UTSW 12 83808205 missense probably damaging 1.00
R5818:Numb UTSW 12 83825254 splice site probably null
R5846:Numb UTSW 12 83876747 utr 5 prime probably benign
R6360:Numb UTSW 12 83797262 missense probably damaging 0.99
R6384:Numb UTSW 12 83803974 missense probably damaging 1.00
R7469:Numb UTSW 12 83803804 missense probably benign 0.37
R7749:Numb UTSW 12 83801277 missense not run
R8342:Numb UTSW 12 83808216 missense probably benign 0.02
R8370:Numb UTSW 12 83808200 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCATGTCCTTGGAAAGG -3'
(R):5'- CCTCCACATGCCTTCAGATGAC -3'

Sequencing Primer
(F):5'- TGCTGGAGGGGCAATGGC -3'
(R):5'- TGACATCGTGCTCTAACAGG -3'
Posted On2019-06-26