Incidental Mutation 'R7186:Wars'
ID559312
Institutional Source Beutler Lab
Gene Symbol Wars
Ensembl Gene ENSMUSG00000021266
Gene Nametryptophanyl-tRNA synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7186 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location108860030-108894174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108881056 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 141 (F141L)
Ref Sequence ENSEMBL: ENSMUSP00000124625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109848] [ENSMUST00000160477] [ENSMUST00000161154] [ENSMUST00000161410] [ENSMUST00000162748]
Predicted Effect probably damaging
Transcript: ENSMUST00000109848
AA Change: F141L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105474
Gene: ENSMUSG00000021266
AA Change: F141L

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160477
Predicted Effect probably damaging
Transcript: ENSMUST00000161154
AA Change: F141L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124625
Gene: ENSMUSG00000021266
AA Change: F141L

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 446 1.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161410
AA Change: F141L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125320
Gene: ENSMUSG00000021266
AA Change: F141L

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162748
SMART Domains Protein: ENSMUSP00000125102
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
PDB:2QUK|A 4 37 1e-8 PDB
SCOP:d1fyja_ 14 37 8e-7 SMART
Blast:WHEP 16 37 3e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. Tryptophanyl-tRNA synthetase (WARS) catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon. Tryptophanyl-tRNA synthetase belongs to the class I tRNA synthetase family. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,019,273 I778F possibly damaging Het
Adam39 A T 8: 40,826,312 N580I probably damaging Het
Adamts20 A G 15: 94,322,808 S1415P possibly damaging Het
Adcy2 A G 13: 68,668,639 Y743H probably damaging Het
Aldh1a3 A G 7: 66,406,083 V320A probably damaging Het
Arid1a TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG 4: 133,753,233 Het
Art5 G T 7: 102,097,329 R268S probably benign Het
Bfar T C 16: 13,692,507 V238A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc23 G A 18: 34,637,122 T408I probably damaging Het
Cdh24 G C 14: 54,633,492 P522A probably benign Het
Clk4 T C 11: 51,268,780 V61A probably benign Het
Clrn2 T C 5: 45,453,773 probably benign Het
Cyp2j8 T C 4: 96,475,550 D292G probably benign Het
Deaf1 T C 7: 141,327,470 E34G probably benign Het
Elovl7 A G 13: 108,271,848 E127G probably damaging Het
Fam46b T A 4: 133,486,207 F130I probably damaging Het
Flg A T 3: 93,279,945 R235* probably null Het
Gbp3 G A 3: 142,564,162 V77M probably damaging Het
Gda A T 19: 21,395,205 F450I probably benign Het
Gipc1 A G 8: 83,664,133 E289G possibly damaging Het
Gm21731 C T 13: 120,241,051 L128F probably damaging Het
Gm4924 T C 10: 82,378,944 Y859H unknown Het
Gpatch1 A T 7: 35,295,313 D509E possibly damaging Het
Gpbp1 A G 13: 111,440,699 V219A possibly damaging Het
Gpr107 A T 2: 31,152,359 M1L possibly damaging Het
Heg1 T C 16: 33,731,664 F1003L probably damaging Het
Hivep1 A G 13: 42,156,338 T685A probably benign Het
Hpse T A 5: 100,695,529 D259V probably damaging Het
Ido2 A T 8: 24,550,810 probably null Het
Ighv14-1 T C 12: 113,932,029 D92G probably damaging Het
Krt83 A T 15: 101,487,202 probably null Het
Lsp1 T C 7: 142,490,352 V278A probably damaging Het
Lurap1l C A 4: 80,911,510 S52R possibly damaging Het
Luzp2 A G 7: 54,835,829 probably benign Het
Micall1 A G 15: 79,125,375 E399G unknown Het
Ncapd2 A G 6: 125,186,156 S130P possibly damaging Het
Nrg2 A G 18: 36,045,920 V321A probably benign Het
Nuf2 T C 1: 169,525,385 H17R probably damaging Het
Numb A G 12: 83,796,146 W419R probably damaging Het
Olfr1318 T A 2: 112,156,162 D70E probably damaging Het
Olfr462 G A 11: 87,889,765 L44F possibly damaging Het
Olfr681 A G 7: 105,122,266 R270G probably benign Het
Pde6a T A 18: 61,220,606 M1K probably null Het
Pknox1 C T 17: 31,603,198 A313V probably damaging Het
Ppp2ca T A 11: 52,119,253 N229K possibly damaging Het
Ptgdr A T 14: 44,858,944 C104S probably damaging Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rfx5 G T 3: 94,958,348 K319N probably benign Het
Rnase10 A T 14: 51,009,785 T207S probably damaging Het
Rreb1 A G 13: 37,941,632 T1305A probably benign Het
Rrp12 C A 19: 41,871,305 probably null Het
Rubcnl A C 14: 75,032,013 D37A possibly damaging Het
Scn9a T C 2: 66,534,223 Y802C probably damaging Het
Sec16a A T 2: 26,440,703 Y433* probably null Het
Sgk3 T A 1: 9,886,002 V331D probably benign Het
Sirt7 C T 11: 120,620,485 R280H probably benign Het
Snx13 G C 12: 35,092,913 R252S probably damaging Het
Stk32b G T 5: 37,466,781 D207E probably damaging Het
Sult2a7 C T 7: 14,470,053 V262I not run Het
Tex45 T C 8: 3,479,049 F208S probably damaging Het
Tmem33 G C 5: 67,263,787 V35L possibly damaging Het
Uba1y A G Y: 825,537 I300V probably benign Het
Usp32 A T 11: 85,051,234 V344E probably benign Het
Usp50 C T 2: 126,783,298 probably benign Het
Vmn1r238 A C 18: 3,122,661 F251C probably damaging Het
Vmn2r74 A T 7: 85,951,942 Y829* probably null Het
Zfp879 A G 11: 50,833,794 V145A probably benign Het
Zfp934 A T 13: 62,492,390 V56D probably benign Het
Other mutations in Wars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01961:Wars APN 12 108866170 missense probably damaging 1.00
IGL02327:Wars APN 12 108866301 critical splice acceptor site probably null
IGL02864:Wars APN 12 108882865 missense probably benign
IGL02962:Wars APN 12 108875780 missense probably damaging 0.99
R0271:Wars UTSW 12 108875193 missense probably benign
R0485:Wars UTSW 12 108875157 missense probably damaging 1.00
R0669:Wars UTSW 12 108866018 missense probably benign 0.00
R1144:Wars UTSW 12 108888365 nonsense probably null
R1581:Wars UTSW 12 108875709 nonsense probably null
R1730:Wars UTSW 12 108875741 missense probably damaging 1.00
R1783:Wars UTSW 12 108875741 missense probably damaging 1.00
R1990:Wars UTSW 12 108888433 missense possibly damaging 0.94
R5382:Wars UTSW 12 108882780 missense probably benign
R5703:Wars UTSW 12 108875121 missense probably damaging 1.00
R6299:Wars UTSW 12 108861383 missense probably benign 0.00
R7508:Wars UTSW 12 108882875 missense probably benign 0.01
R7919:Wars UTSW 12 108881104 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CACTGTGTGGGAAGTACTGG -3'
(R):5'- TGAAGACACCAGGGTCGTTG -3'

Sequencing Primer
(F):5'- ACAGTGTGGGTGTAACTGCAC -3'
(R):5'- TCGTTGAGACAGGTTACTAAGCC -3'
Posted On2019-06-26