Mutagenetix > Incidental Mutation

Incidental Mutation 'R0590:Nr1h4'

55932

Institutional Source

Beutler Lab

Gene Symbol

Nr1h4

Ensembl Gene

ENSMUSG00000047638

Gene Name

nuclear receptor subfamily 1, group H, member 4

Synonyms

Rxrip14, FXR, HRR1, Fxr, RIP14

MMRRC Submission

038780-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.849) question?

Stock #

R0590 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

89454234-89533585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89456567 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 398 (Y398H)

Ref Sequence

ENSEMBL: ENSMUSP00000100933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]

AlphaFold

Q60641

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058126
AA Change: Y394H

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: Y394H

Domain	Start	End	E-Value	Type
ZnF_C4	135	206	1.93e-37	SMART
Blast:HOLI	235	285	4e-19	BLAST
HOLI	301	456	9.43e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105296
AA Change: Y398H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: Y398H

Domain	Start	End	E-Value	Type
ZnF_C4	135	206	1.93e-37	SMART
Blast:HOLI	239	289	4e-19	BLAST
HOLI	305	460	9.43e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105297
AA Change: Y384H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: Y384H

Domain	Start	End	E-Value	Type
ZnF_C4	121	192	1.93e-37	SMART
Blast:HOLI	225	275	3e-19	BLAST
HOLI	291	446	9.43e-32	SMART

Meta Mutation Damage Score

0.2916

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gls	G	A	1: 52,212,375		probably benign	Het
Gria1	A	T	11: 57,289,409	Q728H	probably damaging	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ifngr1	T	A	10: 19,603,942		probably benign	Het
Ipo5	T	C	14: 120,944,357	V954A	possibly damaging	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Kif14	T	C	1: 136,482,472	S646P	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zc3h7b	C	T	15: 81,776,998	T346M	possibly damaging	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Nr1h4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01701:Nr1h4	APN	10	89478807	missense	probably benign	0.42
IGL02628:Nr1h4	APN	10	89473839	missense	probably damaging	1.00
Aeronaut	UTSW	10	89498229	nonsense	probably null
I1329:Nr1h4	UTSW	10	89483362	splice site	probably benign
IGL02837:Nr1h4	UTSW	10	89516480	missense	probably benign	0.00
R0645:Nr1h4	UTSW	10	89506528	missense	probably benign	0.08
R1887:Nr1h4	UTSW	10	89454867	missense	possibly damaging	0.64
R1905:Nr1h4	UTSW	10	89480559	missense	possibly damaging	0.85
R2471:Nr1h4	UTSW	10	89473894	missense	probably damaging	1.00
R2921:Nr1h4	UTSW	10	89498361	missense	probably damaging	1.00
R3177:Nr1h4	UTSW	10	89478788	missense	possibly damaging	0.89
R3277:Nr1h4	UTSW	10	89478788	missense	possibly damaging	0.89
R4656:Nr1h4	UTSW	10	89498253	missense	probably benign	0.00
R4676:Nr1h4	UTSW	10	89473874	missense	probably damaging	1.00
R4901:Nr1h4	UTSW	10	89478797	missense	possibly damaging	0.68
R4993:Nr1h4	UTSW	10	89498180	missense	probably benign	0.01
R5117:Nr1h4	UTSW	10	89478422	missense	probably damaging	1.00
R5131:Nr1h4	UTSW	10	89483455	missense	probably damaging	0.99
R5176:Nr1h4	UTSW	10	89498255	missense	probably benign	0.02
R5241:Nr1h4	UTSW	10	89483489	missense	probably damaging	1.00
R5580:Nr1h4	UTSW	10	89516440	missense	probably benign	0.16
R6114:Nr1h4	UTSW	10	89478816	missense	possibly damaging	0.61
R6814:Nr1h4	UTSW	10	89454745	missense	probably damaging	0.98
R6888:Nr1h4	UTSW	10	89456542	missense	probably damaging	1.00
R6990:Nr1h4	UTSW	10	89454930	missense	probably benign	0.18
R7141:Nr1h4	UTSW	10	89498229	nonsense	probably null
R7427:Nr1h4	UTSW	10	89498405	missense	probably benign	0.00
R7428:Nr1h4	UTSW	10	89498405	missense	probably benign	0.00
R7560:Nr1h4	UTSW	10	89498261	missense	probably benign
R7986:Nr1h4	UTSW	10	89454772	missense	possibly damaging	0.46
R8881:Nr1h4	UTSW	10	89483489	missense	probably damaging	1.00
R9365:Nr1h4	UTSW	10	89483453	missense	probably damaging	0.96
R9423:Nr1h4	UTSW	10	89473826	missense	possibly damaging	0.81
R9659:Nr1h4	UTSW	10	89478776	critical splice donor site	probably null
R9776:Nr1h4	UTSW	10	89483449	missense	probably damaging	1.00
R9788:Nr1h4	UTSW	10	89478776	critical splice donor site	probably null
R9792:Nr1h4	UTSW	10	89478789	missense	probably benign	0.02
R9795:Nr1h4	UTSW	10	89478789	missense	probably benign	0.02
R9800:Nr1h4	UTSW	10	89454756	missense	probably benign	0.03
X0023:Nr1h4	UTSW	10	89454844	missense	possibly damaging	0.45
Z1176:Nr1h4	UTSW	10	89498350	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGTAGTTATTGGAACCATGAGGGC -3'
(R):5'- TCATTACACACTGGCGGGTGAAC -3'

Sequencing Primer
(F):5'- tgagtggtagaattgtgggc -3'
(R):5'- ggagaggaccaatgccac -3'

Posted On

2013-07-11