Incidental Mutation 'R7186:Rrp12'
ID559336
Institutional Source Beutler Lab
Gene Symbol Rrp12
Ensembl Gene ENSMUSG00000035049
Gene Nameribosomal RNA processing 12 homolog (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7186 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41862852-41896153 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 41871305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038677] [ENSMUST00000038677]
Predicted Effect probably null
Transcript: ENSMUST00000038677
SMART Domains Protein: ENSMUSP00000039853
Gene: ENSMUSG00000035049

DomainStartEndE-ValueType
low complexity region 164 175 N/A INTRINSIC
Pfam:NUC173 473 670 1.2e-72 PFAM
SCOP:d1qbkb_ 711 1087 2e-6 SMART
low complexity region 1157 1184 N/A INTRINSIC
low complexity region 1231 1243 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038677
SMART Domains Protein: ENSMUSP00000039853
Gene: ENSMUSG00000035049

DomainStartEndE-ValueType
low complexity region 164 175 N/A INTRINSIC
Pfam:NUC173 473 670 1.2e-72 PFAM
SCOP:d1qbkb_ 711 1087 2e-6 SMART
low complexity region 1157 1184 N/A INTRINSIC
low complexity region 1231 1243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,019,273 I778F possibly damaging Het
Adam39 A T 8: 40,826,312 N580I probably damaging Het
Adamts20 A G 15: 94,322,808 S1415P possibly damaging Het
Adcy2 A G 13: 68,668,639 Y743H probably damaging Het
Aldh1a3 A G 7: 66,406,083 V320A probably damaging Het
Arid1a TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG 4: 133,753,233 Het
Art5 G T 7: 102,097,329 R268S probably benign Het
Bfar T C 16: 13,692,507 V238A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc23 G A 18: 34,637,122 T408I probably damaging Het
Cdh24 G C 14: 54,633,492 P522A probably benign Het
Clk4 T C 11: 51,268,780 V61A probably benign Het
Clrn2 T C 5: 45,453,773 probably benign Het
Cyp2j8 T C 4: 96,475,550 D292G probably benign Het
Deaf1 T C 7: 141,327,470 E34G probably benign Het
Elovl7 A G 13: 108,271,848 E127G probably damaging Het
Fam46b T A 4: 133,486,207 F130I probably damaging Het
Flg A T 3: 93,279,945 R235* probably null Het
Gbp3 G A 3: 142,564,162 V77M probably damaging Het
Gda A T 19: 21,395,205 F450I probably benign Het
Gipc1 A G 8: 83,664,133 E289G possibly damaging Het
Gm21731 C T 13: 120,241,051 L128F probably damaging Het
Gm4924 T C 10: 82,378,944 Y859H unknown Het
Gpatch1 A T 7: 35,295,313 D509E possibly damaging Het
Gpbp1 A G 13: 111,440,699 V219A possibly damaging Het
Gpr107 A T 2: 31,152,359 M1L possibly damaging Het
Heg1 T C 16: 33,731,664 F1003L probably damaging Het
Hivep1 A G 13: 42,156,338 T685A probably benign Het
Hpse T A 5: 100,695,529 D259V probably damaging Het
Ido2 A T 8: 24,550,810 probably null Het
Ighv14-1 T C 12: 113,932,029 D92G probably damaging Het
Krt83 A T 15: 101,487,202 probably null Het
Lsp1 T C 7: 142,490,352 V278A probably damaging Het
Lurap1l C A 4: 80,911,510 S52R possibly damaging Het
Luzp2 A G 7: 54,835,829 probably benign Het
Micall1 A G 15: 79,125,375 E399G unknown Het
Ncapd2 A G 6: 125,186,156 S130P possibly damaging Het
Nrg2 A G 18: 36,045,920 V321A probably benign Het
Nuf2 T C 1: 169,525,385 H17R probably damaging Het
Numb A G 12: 83,796,146 W419R probably damaging Het
Olfr1318 T A 2: 112,156,162 D70E probably damaging Het
Olfr462 G A 11: 87,889,765 L44F possibly damaging Het
Olfr681 A G 7: 105,122,266 R270G probably benign Het
Pde6a T A 18: 61,220,606 M1K probably null Het
Pknox1 C T 17: 31,603,198 A313V probably damaging Het
Ppp2ca T A 11: 52,119,253 N229K possibly damaging Het
Ptgdr A T 14: 44,858,944 C104S probably damaging Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rfx5 G T 3: 94,958,348 K319N probably benign Het
Rnase10 A T 14: 51,009,785 T207S probably damaging Het
Rreb1 A G 13: 37,941,632 T1305A probably benign Het
Rubcnl A C 14: 75,032,013 D37A possibly damaging Het
Scn9a T C 2: 66,534,223 Y802C probably damaging Het
Sec16a A T 2: 26,440,703 Y433* probably null Het
Sgk3 T A 1: 9,886,002 V331D probably benign Het
Sirt7 C T 11: 120,620,485 R280H probably benign Het
Snx13 G C 12: 35,092,913 R252S probably damaging Het
Stk32b G T 5: 37,466,781 D207E probably damaging Het
Sult2a7 C T 7: 14,470,053 V262I not run Het
Tex45 T C 8: 3,479,049 F208S probably damaging Het
Tmem33 G C 5: 67,263,787 V35L possibly damaging Het
Uba1y A G Y: 825,537 I300V probably benign Het
Usp32 A T 11: 85,051,234 V344E probably benign Het
Usp50 C T 2: 126,783,298 probably benign Het
Vmn1r238 A C 18: 3,122,661 F251C probably damaging Het
Vmn2r74 A T 7: 85,951,942 Y829* probably null Het
Wars A G 12: 108,881,056 F141L probably damaging Het
Zfp879 A G 11: 50,833,794 V145A probably benign Het
Zfp934 A T 13: 62,492,390 V56D probably benign Het
Other mutations in Rrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Rrp12 APN 19 41887094 missense possibly damaging 0.94
IGL00430:Rrp12 APN 19 41877334 critical splice donor site probably null
IGL00496:Rrp12 APN 19 41878027 critical splice donor site probably null
IGL00953:Rrp12 APN 19 41871792 missense possibly damaging 0.51
IGL01320:Rrp12 APN 19 41877936 missense probably damaging 1.00
IGL01479:Rrp12 APN 19 41865202 missense probably benign 0.05
IGL01939:Rrp12 APN 19 41870895 missense probably damaging 0.99
IGL02147:Rrp12 APN 19 41886181 missense probably damaging 1.00
IGL02255:Rrp12 APN 19 41872971 missense probably damaging 1.00
IGL02756:Rrp12 APN 19 41896061 missense probably benign 0.03
IGL02793:Rrp12 APN 19 41871566 missense probably damaging 1.00
IGL03026:Rrp12 APN 19 41872997 missense probably damaging 1.00
IGL03202:Rrp12 APN 19 41868766 splice site probably null
IGL03393:Rrp12 APN 19 41871793 missense possibly damaging 0.91
R0137:Rrp12 UTSW 19 41873850 missense probably benign
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0522:Rrp12 UTSW 19 41874705 splice site probably benign
R0616:Rrp12 UTSW 19 41892549 missense possibly damaging 0.95
R1509:Rrp12 UTSW 19 41882200 missense probably damaging 1.00
R1537:Rrp12 UTSW 19 41886803 missense probably damaging 0.97
R1593:Rrp12 UTSW 19 41863241 missense probably benign 0.00
R1635:Rrp12 UTSW 19 41868785 missense probably benign 0.00
R1642:Rrp12 UTSW 19 41871737 missense probably damaging 1.00
R1696:Rrp12 UTSW 19 41873749 missense probably damaging 1.00
R1827:Rrp12 UTSW 19 41880481 missense possibly damaging 0.95
R1844:Rrp12 UTSW 19 41877783 critical splice donor site probably null
R1950:Rrp12 UTSW 19 41892590 missense probably damaging 1.00
R2010:Rrp12 UTSW 19 41872937 missense probably benign
R2115:Rrp12 UTSW 19 41891094 missense probably benign 0.38
R2136:Rrp12 UTSW 19 41892599 missense probably damaging 1.00
R2386:Rrp12 UTSW 19 41871284 missense probably benign 0.41
R3741:Rrp12 UTSW 19 41885728 missense probably damaging 1.00
R4096:Rrp12 UTSW 19 41887148 missense probably benign 0.32
R4292:Rrp12 UTSW 19 41872905 splice site probably null
R4407:Rrp12 UTSW 19 41892551 missense probably damaging 1.00
R4629:Rrp12 UTSW 19 41883516 missense probably benign 0.03
R4698:Rrp12 UTSW 19 41873042 missense probably benign 0.12
R4702:Rrp12 UTSW 19 41871536 missense probably damaging 1.00
R4716:Rrp12 UTSW 19 41877428 missense probably damaging 1.00
R4837:Rrp12 UTSW 19 41877505 splice site probably null
R5282:Rrp12 UTSW 19 41876590 missense probably benign
R5327:Rrp12 UTSW 19 41892596 missense probably damaging 1.00
R5621:Rrp12 UTSW 19 41880417 missense probably benign
R5762:Rrp12 UTSW 19 41880152 missense possibly damaging 0.88
R5947:Rrp12 UTSW 19 41870808 critical splice donor site probably null
R6213:Rrp12 UTSW 19 41868778 missense probably benign
R6407:Rrp12 UTSW 19 41883742 missense probably damaging 0.98
R6980:Rrp12 UTSW 19 41890143 missense probably damaging 0.98
R7179:Rrp12 UTSW 19 41883778 missense probably benign 0.03
R7194:Rrp12 UTSW 19 41871540 missense probably benign
R7206:Rrp12 UTSW 19 41878039 missense probably damaging 1.00
R7209:Rrp12 UTSW 19 41872949 missense possibly damaging 0.62
R7248:Rrp12 UTSW 19 41883438 missense possibly damaging 0.82
R7976:Rrp12 UTSW 19 41891109 missense probably benign 0.04
R8075:Rrp12 UTSW 19 41863274 missense probably damaging 0.96
R8322:Rrp12 UTSW 19 41880219 missense probably benign 0.09
Z1177:Rrp12 UTSW 19 41865567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACCAAGGACTCGATG -3'
(R):5'- CATCAGGAAAGCTGAGACCC -3'

Sequencing Primer
(F):5'- ACTCGATGGGCCACCTTG -3'
(R):5'- AAGAAGCATCGTGCCCTG -3'
Posted On2019-06-26