Mutagenetix > Incidental Mutation

Incidental Mutation 'R0590:Gria1'

55934

Institutional Source

Beutler Lab

Gene Symbol

Gria1

Ensembl Gene

ENSMUSG00000020524

Gene Name

glutamate receptor, ionotropic, AMPA1 (alpha 1)

Synonyms

Glr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1

MMRRC Submission

038780-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0590 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57011387-57330244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57289409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 728 (Q728H)

Ref Sequence

ENSEMBL: ENSMUSP00000091731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]

AlphaFold

P23818

Predicted Effect

probably damaging
Transcript: ENSMUST00000036315
AA Change: Q728H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: Q728H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	37	372	9.3e-63	PFAM
PBPe	408	783	3.65e-121	SMART
Lig_chan-Glu_bd	418	483	1.65e-29	SMART
low complexity region	863	874	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094179
AA Change: Q728H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524
AA Change: Q728H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	37	372	3.7e-69	PFAM
PBPe	408	783	2.09e-121	SMART
Lig_chan-Glu_bd	418	483	1.65e-29	SMART
low complexity region	863	874	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000151045
AA Change: Q659H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: Q659H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	303	4.7e-58	PFAM
PBPe	339	714	3.65e-121	SMART
Lig_chan-Glu_bd	349	414	1.65e-29	SMART
transmembrane domain	739	761	N/A	INTRINSIC
low complexity region	794	805	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gls	G	A	1: 52,212,375		probably benign	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ifngr1	T	A	10: 19,603,942		probably benign	Het
Ipo5	T	C	14: 120,944,357	V954A	possibly damaging	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Kif14	T	C	1: 136,482,472	S646P	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nr1h4	A	G	10: 89,456,567	Y398H	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zc3h7b	C	T	15: 81,776,998	T346M	possibly damaging	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Gria1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Gria1	APN	11	57242941	nonsense	probably null
IGL00807:Gria1	APN	11	57012040	missense	probably benign
IGL00816:Gria1	APN	11	57317742	missense	possibly damaging	0.93
IGL01110:Gria1	APN	11	57289381	missense	probably damaging	1.00
IGL01116:Gria1	APN	11	57236975	missense	probably damaging	1.00
IGL01120:Gria1	APN	11	57317669	missense	probably damaging	0.99
IGL01843:Gria1	APN	11	57317774	missense	probably damaging	1.00
IGL02135:Gria1	APN	11	57185853	missense	probably damaging	1.00
IGL02308:Gria1	APN	11	57236924	missense	probably benign	0.00
IGL02554:Gria1	APN	11	57289488	missense	possibly damaging	0.72
IGL02813:Gria1	APN	11	57283584	missense	probably damaging	1.00
IGL03071:Gria1	APN	11	57012110	splice site	probably null
IGL03326:Gria1	APN	11	57317773	missense	probably damaging	1.00
PIT4445001:Gria1	UTSW	11	57185838	missense	probably damaging	1.00
R0087:Gria1	UTSW	11	57317712	missense	probably damaging	1.00
R0387:Gria1	UTSW	11	57309884	critical splice donor site	probably null
R0399:Gria1	UTSW	11	57186027	missense	probably damaging	0.97
R0502:Gria1	UTSW	11	57189716	missense	probably damaging	1.00
R0503:Gria1	UTSW	11	57189716	missense	probably damaging	1.00
R0549:Gria1	UTSW	11	57228973	missense	probably damaging	1.00
R1377:Gria1	UTSW	11	57201176	missense	probably damaging	1.00
R1395:Gria1	UTSW	11	57283566	missense	probably damaging	1.00
R1422:Gria1	UTSW	11	57189788	missense	probably benign	0.00
R1581:Gria1	UTSW	11	57237010	splice site	probably null
R2002:Gria1	UTSW	11	57012104	missense	possibly damaging	0.93
R2064:Gria1	UTSW	11	57317708	missense	probably damaging	0.98
R2255:Gria1	UTSW	11	57185949	missense	probably damaging	1.00
R2507:Gria1	UTSW	11	57289320	missense	probably null	0.30
R2965:Gria1	UTSW	11	57185801	nonsense	probably null
R3012:Gria1	UTSW	11	57289434	missense	probably damaging	1.00
R3151:Gria1	UTSW	11	57283562	missense	probably damaging	1.00
R3807:Gria1	UTSW	11	57310678	missense	probably damaging	1.00
R5026:Gria1	UTSW	11	57310696	missense	probably damaging	1.00
R5132:Gria1	UTSW	11	57289399	missense	probably damaging	1.00
R5222:Gria1	UTSW	11	57189797	missense	probably benign	0.22
R5303:Gria1	UTSW	11	57243025	missense	probably benign	0.01
R5332:Gria1	UTSW	11	57327621	missense	possibly damaging	0.93
R5413:Gria1	UTSW	11	57217794	missense	probably benign	0.00
R5748:Gria1	UTSW	11	57309876	missense	probably benign	0.00
R5878:Gria1	UTSW	11	57317802	critical splice donor site	probably null
R5937:Gria1	UTSW	11	57189733	missense	probably benign	0.00
R5995:Gria1	UTSW	11	57289285	missense	probably damaging	1.00
R6031:Gria1	UTSW	11	57217782	missense	probably damaging	1.00
R6031:Gria1	UTSW	11	57217782	missense	probably damaging	1.00
R6180:Gria1	UTSW	11	57242792	missense	probably damaging	1.00
R6187:Gria1	UTSW	11	57238110	missense	possibly damaging	0.84
R6262:Gria1	UTSW	11	57242854	missense	probably damaging	1.00
R6828:Gria1	UTSW	11	57289462	missense	probably damaging	1.00
R7374:Gria1	UTSW	11	57189808	missense	probably benign
R7507:Gria1	UTSW	11	57228939	missense	probably benign	0.14
R7511:Gria1	UTSW	11	57283625	missense	probably damaging	1.00
R7691:Gria1	UTSW	11	57236987	missense	possibly damaging	0.94
R7898:Gria1	UTSW	11	57242765	missense	probably damaging	1.00
R7931:Gria1	UTSW	11	57310525	intron	probably benign
R7956:Gria1	UTSW	11	57189800	missense	possibly damaging	0.93
R8189:Gria1	UTSW	11	57217799	missense	probably benign	0.00
R8353:Gria1	UTSW	11	57243051	missense	probably damaging	1.00
R8453:Gria1	UTSW	11	57243051	missense	probably damaging	1.00
R8472:Gria1	UTSW	11	57327584	missense	probably benign	0.11
R8478:Gria1	UTSW	11	57309842	missense	probably damaging	1.00
R9165:Gria1	UTSW	11	57185933	missense	possibly damaging	0.96
R9243:Gria1	UTSW	11	57238062	missense	probably benign	0.06
R9450:Gria1	UTSW	11	57309789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTGATCAAGCTCCACTCAGCTC -3'
(R):5'- TGGTAAATGCAGCAGCTTCGGTCC -3'

Sequencing Primer
(F):5'- ATGGCTTAACCCTGGTTTCG -3'
(R):5'- AGCTTCGGTCCTGAGAGAG -3'

Posted On

2013-07-11