Incidental Mutation 'R7187:Rundc3b'
ID559349
Institutional Source Beutler Lab
Gene Symbol Rundc3b
Ensembl Gene ENSMUSG00000040570
Gene NameRUN domain containing 3B
SynonymsLOC242819
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R7187 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8490334-8622952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8492506 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 389 (S389P)
Ref Sequence ENSEMBL: ENSMUSP00000040108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047485] [ENSMUST00000115378]
Predicted Effect probably damaging
Transcript: ENSMUST00000047485
AA Change: S389P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040108
Gene: ENSMUSG00000040570
AA Change: S389P

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115378
AA Change: S438P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111036
Gene: ENSMUSG00000040570
AA Change: S438P

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,437,721 Y716C probably damaging Het
Abcc1 A G 16: 14,466,997 I1237V probably benign Het
Adam34 C T 8: 43,652,528 A27T probably benign Het
Aff3 T C 1: 38,218,397 S415G probably damaging Het
Ak7 T C 12: 105,745,273 Y390H probably benign Het
Arap2 A C 5: 62,669,053 M1056R probably damaging Het
Brf1 T C 12: 112,960,325 Y676C unknown Het
Cachd1 T A 4: 100,976,355 H776Q possibly damaging Het
Cacng7 T C 7: 3,336,667 V28A probably damaging Het
Camk2g A T 14: 20,742,712 D359E probably benign Het
Cd209b T C 8: 3,926,638 D16G probably benign Het
Ceacam5 A G 7: 17,759,485 E811G possibly damaging Het
Cecr2 T A 6: 120,756,686 S545T probably benign Het
Cep55 T C 19: 38,060,358 probably null Het
Ctif C A 18: 75,637,219 V32L probably damaging Het
Cwc27 G A 13: 104,661,392 A353V probably benign Het
Dclk3 T A 9: 111,484,996 S713R probably damaging Het
Dlec1 C T 9: 119,112,146 H255Y probably benign Het
Dlgap1 A G 17: 70,516,098 H26R possibly damaging Het
Dydc1 C T 14: 41,078,094 T19I possibly damaging Het
Efcab12 G A 6: 115,823,513 P183L not run Het
Eri3 C A 4: 117,589,146 Q219K probably benign Het
Fam135a A G 1: 24,044,214 L310P probably damaging Het
Fgd5 T A 6: 91,988,291 S502T possibly damaging Het
Fgf8 A G 19: 45,741,667 S57P probably benign Het
Gls T C 1: 52,219,980 E154G probably damaging Het
Gm21319 T C 12: 87,773,938 probably benign Het
Gm28042 T C 2: 120,039,695 L705P probably damaging Het
Golgb1 C A 16: 36,916,150 Q1961K probably benign Het
Herc3 C A 6: 58,856,631 Q168K probably benign Het
Il31ra C A 13: 112,546,311 C168F probably benign Het
Ino80 A T 2: 119,426,591 D860E probably benign Het
Iqcm T G 8: 75,753,416 L334R probably benign Het
Lrrk2 A G 15: 91,757,001 D1587G possibly damaging Het
Map4 T A 9: 110,053,133 V355E probably benign Het
Mapk13 T A 17: 28,776,387 I194N probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Naglu G T 11: 101,070,332 G70W probably benign Het
Nlrp4f A T 13: 65,195,387 M126K possibly damaging Het
Olfr1225 T C 2: 89,171,370 probably benign Het
Olfr485 A T 7: 108,159,378 V165E probably benign Het
Pdia4 T C 6: 47,813,259 T16A unknown Het
Pou6f2 G A 13: 18,239,713 A159V Het
Ripor1 A G 8: 105,617,874 T547A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,212,173 S484P probably benign Het
Supv3l1 G A 10: 62,435,549 T403I probably damaging Het
Tacstd2 G A 6: 67,535,196 R171W probably damaging Het
Taok2 A T 7: 126,872,380 F542L probably damaging Het
Tbc1d31 T A 15: 57,938,063 N331K possibly damaging Het
Tff2 A T 17: 31,142,226 C118S probably damaging Het
Tmprss7 G A 16: 45,677,954 T354I possibly damaging Het
Tmtc3 A T 10: 100,477,912 F33I probably damaging Het
Tpbpa G A 13: 60,940,585 probably benign Het
Ube3a G T 7: 59,275,905 V165F probably benign Het
Vmn2r4 T G 3: 64,415,260 T13P probably benign Het
Wnt8b A G 19: 44,511,682 D236G probably benign Het
Ythdf3 C A 3: 16,204,287 D210E probably benign Het
Zfp110 T A 7: 12,849,826 Y800* probably null Het
Other mutations in Rundc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rundc3b APN 5 8569553 missense probably damaging 0.98
IGL01726:Rundc3b APN 5 8520902 missense probably benign 0.24
IGL02271:Rundc3b APN 5 8492530 missense probably damaging 1.00
IGL03394:Rundc3b APN 5 8548261 missense possibly damaging 0.93
F5770:Rundc3b UTSW 5 8622549 small deletion probably benign
R0656:Rundc3b UTSW 5 8569529 missense probably damaging 1.00
R1702:Rundc3b UTSW 5 8512318 missense probably benign
R1776:Rundc3b UTSW 5 8579050 missense probably damaging 1.00
R1829:Rundc3b UTSW 5 8579117 missense probably damaging 1.00
R2011:Rundc3b UTSW 5 8512409 critical splice acceptor site probably null
R3606:Rundc3b UTSW 5 8512386 missense probably damaging 1.00
R4841:Rundc3b UTSW 5 8528742 missense probably damaging 1.00
R6452:Rundc3b UTSW 5 8579175 intron probably null
R6642:Rundc3b UTSW 5 8579071 missense probably damaging 1.00
R7022:Rundc3b UTSW 5 8512348 missense probably null 0.00
R7310:Rundc3b UTSW 5 8521011 nonsense probably null
R7391:Rundc3b UTSW 5 8559455 missense probably benign 0.00
V7582:Rundc3b UTSW 5 8622549 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGCTGGACTAAAATCTCC -3'
(R):5'- AGGTTTAGCGGCATCGATAC -3'

Sequencing Primer
(F):5'- GGGCTGGACTAAAATCTCCAAACAAC -3'
(R):5'- AGCGGCATCGATACATTGTC -3'
Posted On2019-06-26