Incidental Mutation 'R7187:Herc3'
ID559353
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7187 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58856631 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 168 (Q168K)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000126292]
Predicted Effect probably benign
Transcript: ENSMUST00000031823
AA Change: Q168K

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: Q168K

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041401
AA Change: Q168K

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: Q168K

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126292
SMART Domains Protein: ENSMUSP00000122401
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.5e-12 PFAM
Pfam:RCC1 52 77 1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,437,721 Y716C probably damaging Het
Abcc1 A G 16: 14,466,997 I1237V probably benign Het
Adam34 C T 8: 43,652,528 A27T probably benign Het
Aff3 T C 1: 38,218,397 S415G probably damaging Het
Ak7 T C 12: 105,745,273 Y390H probably benign Het
Arap2 A C 5: 62,669,053 M1056R probably damaging Het
Brf1 T C 12: 112,960,325 Y676C unknown Het
Cachd1 T A 4: 100,976,355 H776Q possibly damaging Het
Cacng7 T C 7: 3,336,667 V28A probably damaging Het
Camk2g A T 14: 20,742,712 D359E probably benign Het
Cd209b T C 8: 3,926,638 D16G probably benign Het
Ceacam5 A G 7: 17,759,485 E811G possibly damaging Het
Cecr2 T A 6: 120,756,686 S545T probably benign Het
Cep55 T C 19: 38,060,358 probably null Het
Ctif C A 18: 75,637,219 V32L probably damaging Het
Cwc27 G A 13: 104,661,392 A353V probably benign Het
Dclk3 T A 9: 111,484,996 S713R probably damaging Het
Dlec1 C T 9: 119,112,146 H255Y probably benign Het
Dlgap1 A G 17: 70,516,098 H26R possibly damaging Het
Dydc1 C T 14: 41,078,094 T19I possibly damaging Het
Efcab12 G A 6: 115,823,513 P183L not run Het
Eri3 C A 4: 117,589,146 Q219K probably benign Het
Fam135a A G 1: 24,044,214 L310P probably damaging Het
Fgd5 T A 6: 91,988,291 S502T possibly damaging Het
Fgf8 A G 19: 45,741,667 S57P probably benign Het
Gls T C 1: 52,219,980 E154G probably damaging Het
Gm21319 T C 12: 87,773,938 probably benign Het
Gm28042 T C 2: 120,039,695 L705P probably damaging Het
Golgb1 C A 16: 36,916,150 Q1961K probably benign Het
Il31ra C A 13: 112,546,311 C168F probably benign Het
Ino80 A T 2: 119,426,591 D860E probably benign Het
Iqcm T G 8: 75,753,416 L334R probably benign Het
Lrrk2 A G 15: 91,757,001 D1587G possibly damaging Het
Map4 T A 9: 110,053,133 V355E probably benign Het
Mapk13 T A 17: 28,776,387 I194N probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Naglu G T 11: 101,070,332 G70W probably benign Het
Nlrp4f A T 13: 65,195,387 M126K possibly damaging Het
Olfr1225 T C 2: 89,171,370 probably benign Het
Olfr485 A T 7: 108,159,378 V165E probably benign Het
Pdia4 T C 6: 47,813,259 T16A unknown Het
Pou6f2 G A 13: 18,239,713 A159V Het
Ripor1 A G 8: 105,617,874 T547A probably benign Het
Rundc3b A G 5: 8,492,506 S389P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,212,173 S484P probably benign Het
Supv3l1 G A 10: 62,435,549 T403I probably damaging Het
Tacstd2 G A 6: 67,535,196 R171W probably damaging Het
Taok2 A T 7: 126,872,380 F542L probably damaging Het
Tbc1d31 T A 15: 57,938,063 N331K possibly damaging Het
Tff2 A T 17: 31,142,226 C118S probably damaging Het
Tmprss7 G A 16: 45,677,954 T354I possibly damaging Het
Tmtc3 A T 10: 100,477,912 F33I probably damaging Het
Tpbpa G A 13: 60,940,585 probably benign Het
Ube3a G T 7: 59,275,905 V165F probably benign Het
Vmn2r4 T G 3: 64,415,260 T13P probably benign Het
Wnt8b A G 19: 44,511,682 D236G probably benign Het
Ythdf3 C A 3: 16,204,287 D210E probably benign Het
Zfp110 T A 7: 12,849,826 Y800* probably null Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 splice site probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R8321:Herc3 UTSW 6 58843769 missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58873801 missense probably damaging 0.96
R8684:Herc3 UTSW 6 58887576 missense probably damaging 1.00
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTCTGGTCAAATGCTAATTTAGG -3'
(R):5'- TTTCATCACTGAGCCCTAGC -3'

Sequencing Primer
(F):5'- GGCTTTCGAAATCTGAAAACACAGTG -3'
(R):5'- AGCTGCCCTGCATTATTCATTC -3'
Posted On2019-06-26